Busch Lab

ZMP

GARL3_DANRE

Ensembl ID:
ENSDARG00000060631
Description:
GTPase-activating Rap/Ran-GAP domain-like protein 3 [Source:UniProtKB/Swiss-Prot;Acc:A5PF44]
Human Orthologue:
GARNL3
Human Description:
GTPase activating Rap/RanGAP domain-like 3 [Source:HGNC Symbol;Acc:25425]
Mouse Orthologue:
Garnl3
Mouse Description:
GTPase activating RANGAP domain-like 3 Gene [Source:MGI Symbol;Acc:MGI:2139309]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa9912 Nonsense Available for shipment Available now
sa40481 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31462 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9912
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085636 Nonsense 262 870 10 25
Genomic Location (Zv9):
Chromosome 5 (position 35005545)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32787494
GRCz11 5 33387647
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGGAAGAGACACATTGGGAACGACATCGTGACCATCGTGTTTCAGGAG[G/T]GAGATGACGYCTCGCCGTCCTTYAAACCCTCCATGATTCGCTCCCATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40481
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085636 Essential Splice Site 370 870 14 25
Genomic Location (Zv9):
Chromosome 5 (position 35000084)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32782033
GRCz11 5 33382186
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAGACCCATGTTTATCTGTACTGCTCCTGTAGGTTCCCTTCTCTCCGC[A/T]GAACATGCTGAATCGACGCTCATTCAGCGATGTCCTGCCAGAGTCACCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26514
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085636 Essential Splice Site 502 870 17 25
Genomic Location (Zv9):
Chromosome 5 (position 34996411)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32778360
GRCz11 5 33378513
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGCACGTGCTTGAACCTCAGGACCTCCTCATTGCAAGAGCAGACAAAG[G/A]TAGGAAATGTGTTTGCTTTCATATTCATATGAGCAAATGAAAATGGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31462
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085636 Nonsense 557 870 19 25
Genomic Location (Zv9):
Chromosome 5 (position 34989868)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32771817
GRCz11 5 33371970
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCAGGCTGCCATCTCTACTCCATAAACACACATCATGGAGTGGAGCTC[A/T]GAATTGTTGCGGCGATAAGAAACAAGCTCCTTCTGATCACCAGGAAACAG
Associated Phenotype:
Not determined