Busch Lab

ZMP

NP_001038780.1

Ensembl ID:
ENSDARG00000060626
Description:
diacylglycerol kinase alpha [Source:RefSeq peptide;Acc:NP_001038780]
Human Orthologue:
DGKA
Human Description:
diacylglycerol kinase, alpha 80kDa [Source:HGNC Symbol;Acc:2849]
Mouse Orthologue:
Dgka
Mouse Description:
diacylglycerol kinase, alpha Gene [Source:MGI Symbol;Acc:MGI:102952]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa17147 Essential Splice Site Available for shipment Available now
sa29975 Nonsense Mutation detected in F1 DNA Not yet available
sa8725 Nonsense Mutation detected in F1 DNA Not yet available
sa16576 Nonsense Available for shipment Available now
sa45808 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17147
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085642 Essential Splice Site 371 727 13 24
ENSDART00000134883 Essential Splice Site 320 676 10 21
ENSDART00000143013 None None 90 None 3
Genomic Location (Zv9):
Chromosome 23 (position 32488851)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32323741
GRCz11 23 32250272
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATGATGACAGTGAGCTCAACACCACACCTGATGGRCAGGTGCTGCGGG[T/C]AGGACTCTGATAYATCTCTACWACTGCATCCACACACKGAAYGATGAGRG
Long Flanking Sequence:
CAGACTAAAAAAGTAAGACCTTCTCCTGAAGAAAAATATAATAGGAAGGAAATACTATGAGAAATGTCCTTGCTCTGTTATAAATAACTCAGGAAATATTTGAAAAAACTATTTATATTTATAATTGATAACATTTTAGCCAGCCTTTAGTATAAATAACCACTGAAAAACGCTATACTAGCCTGCAAAACTCTAAAAAAAAAGCCAAAAAGGCTGTTAAAAAGCTAAATACAAACAACAACATGACTAGTTAGTTAAAAAAAGAAAATACAGCTTTAAATCAGCAAGTTGGTAAAAGAAAACTCAGCTTAAATAGTTAAAAATAATGTATAAACTACAGAAGCAGATCAAATGCAGATAAACTGTGATTTGATCGTCCATTGTACCTACTGTTTTGTGTTCCCTCATCTAGGAAAGGCCGAACTGCATAAAGAACGGCGGCTCATTTCCAGATGATGACAGTGAGCTCAACACCACACCTGATGGGCAGGTGCTGCGGG[T/C]AGGACTCTGATATATCTCTACAACTGCATCCACACACGGAATGATGAGAGTGAAACTAAAGCACAGTCTTCTCTTCTCCAAACAGATCAGCCCCATTCCAGACACTCGTCCTCTTTTGGTGTTTGTCAATCCTAAAAGTGGAGGTAAACAGGGAGAAAGGTGAGAACACGTATATCCATCTAATATATTATGTGTGTTTTTTAGAAGAATAGATTTATTGTCATTGTCACAAGTACAAGTAATTTTAAAAAGTGCTCTCCAGTCAGTGCAACAATCATTTTGTCTATAAAAAATATTAAGTGCTAAAATTACTAAAATAAATTGTAAAAACTACAGATATTTACAATAGAATATGATCAAATATGCTCTAAGACATAACATCTACATAACTACTAAATTACATAAGTAAACTAAACAAATGAAGTCAGTAAATTTGTGTTTTACAGGGTCCTTCGGAAATTTCAGTACTTATTGAATCCTCGGCAGGTTTATAACCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29975
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085642 Nonsense 388 727 14 24
ENSDART00000134883 Nonsense 337 676 11 21
ENSDART00000143013 None None 90 None 3
Genomic Location (Zv9):
Chromosome 23 (position 32488717)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32323607
GRCz11 23 32250138
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATCAGCCCCATTCCAGACACTCGTCCTCTTTTGGTGTTTGTCAATCCT[A/T]AAAGTGGAGGTAAACAGGGAGAAAGGTGAGAACACGTATATCCATCTAAT
Long Flanking Sequence:
TTTAGCCAGCCTTTAGTATAAATAACCACTGAAAAACGCTATACTAGCCTGCAAAACTCTAAAAAAAAAGCCAAAAAGGCTGTTAAAAAGCTAAATACAAACAACAACATGACTAGTTAGTTAAAAAAAGAAAATACAGCTTTAAATCAGCAAGTTGGTAAAAGAAAACTCAGCTTAAATAGTTAAAAATAATGTATAAACTACAGAAGCAGATCAAATGCAGATAAACTGTGATTTGATCGTCCATTGTACCTACTGTTTTGTGTTCCCTCATCTAGGAAAGGCCGAACTGCATAAAGAACGGCGGCTCATTTCCAGATGATGACAGTGAGCTCAACACCACACCTGATGGGCAGGTGCTGCGGGTAGGACTCTGATATATCTCTACAACTGCATCCACACACGGAATGATGAGAGTGAAACTAAAGCACAGTCTTCTCTTCTCCAAACAGATCAGCCCCATTCCAGACACTCGTCCTCTTTTGGTGTTTGTCAATCCT[A/T]AAAGTGGAGGTAAACAGGGAGAAAGGTGAGAACACGTATATCCATCTAATATATTATGTGTGTTTTTTAGAAGAATAGATTTATTGTCATTGTCACAAGTACAAGTAATTTTAAAAAGTGCTCTCCAGTCAGTGCAACAATCATTTTGTCTATAAAAAATATTAAGTGCTAAAATTACTAAAATAAATTGTAAAAACTACAGATATTTACAATAGAATATGATCAAATATGCTCTAAGACATAACATCTACATAACTACTAAATTACATAAGTAAACTAAACAAATGAAGTCAGTAAATTTGTGTTTTACAGGGTCCTTCGGAAATTTCAGTACTTATTGAATCCTCGGCAGGTTTATAACCTTTCCAATGGTGGACCAGGACCAGGGTAAGGATTTTTACTACAATTTTTATATACAGCATATACAAAATTATTAGCCTTCCTGCTTTTTATATGAATTTTTTTTTAATTTTCTAAATATTTCTTAACTGATGTTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8725
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085642 Nonsense 422 727 16 24
ENSDART00000134883 Nonsense 371 676 13 21
ENSDART00000143013 None None 90 None 3
Genomic Location (Zv9):
Chromosome 23 (position 32487238)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32322128
GRCz11 23 32248659
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACACTTGAAGGTGGTCATAATCGATTTAATACTCTGTTTTCAAACCAGGT[T/A]GAGTTTCTTCAGAGACGTGCCGAATTACAGAATATTAGTTTGCGGAGGCG
Long Flanking Sequence:
ATGCAGTTTGTAAAATAATATTTTCTGTCTTTTAGGAGATATATTATTATAGATTATTTAATAGTTATTAAAATCTTTTTTCTTTTGAACATCATTTCAATTGACCTAATAATAATTAAATAAAATGCTAATAATTTTGCCTTTAACTGTATAAGCCTGTATTGGCTCAAACGATGGAAAAAGTTCTTCAGTTTACTTGCATATTGTGTGTCAGATAAGCTAAATAAATTGGTGTGCCATACATACCCAGATCCAAAATGACCTGAACATGAAAAGAGTATTGTTTTAGTGGTTACACTGCTTAAAAAAAAGAATTGCAGAAAATCTAAATAAATCGTGTGTATTTTGAGGATAATGCGTGTATAAAGTTTCATTCGCTCACTAAACATTATGCATTATAAAGACAAATTTATGAATATTTTTGGTAATCAGTAAATTATGAGTGCTAAGACACTTGAAGGTGGTCATAATCGATTTAATACTCTGTTTTCAAACCAGGT[T/A]GAGTTTCTTCAGAGACGTGCCGAATTACAGAATATTAGTTTGCGGAGGCGATGGCACAGTGGGGTGGATTCTTGATGCTATAGGTTGGAAACCGACACACATTCACAGCAAATCCATGTGAGCAAGCTTTGCTCTGATTTCACTTTCAACCAACTGCTCTTTTCAATTCCTCAAAGATAAAGCCAATCTGCCGGTGCGCCCTCCGGTGGCTGTGCTTCCTCTGGGAACAGGAAATGATCTTGCACGCTGTCTTCGATGGGGAGGAGGTGAGGACAAAGGCTTCTACCTGTACCTGAAGATTGAACAAATATTTGCATGTAGTTGAGAGCTGCACGGTATTGGAAATTTTGATTTAGTTTTAGTTTCACTGTGTTTTTAATGGTCTCTTTTGCAGGGTTAGTCGGCTATAGTTACATATCAACCAATTCTTATTAGACTATTATTTGTCAAACTGTTTGCTTAATATCTGCAGACCTTAATCCACAGACATTAAACACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16576
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085642 Nonsense 522 727 18 24
ENSDART00000134883 Nonsense 471 676 15 21
ENSDART00000143013 None None 90 None 3
Genomic Location (Zv9):
Chromosome 23 (position 32484923)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32319813
GRCz11 23 32246344
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATACAGGTGACTCTGGAGGACAGTCAGGAGAGAGGAGACCCTGTGCCCTA[C/A]GAAATCATCAAMAACTATTTCTCCATCGGAGTGGTGAGACTYGTAGAGTA
Long Flanking Sequence:
GTGATCAGCTCCTTTAGAAATATTATTCCCTGGAAAAAACATGAAATGTTCAATACTACAGCACTTTGAACATTCAACAATTAATCTTTATTAAAGCTGGAAACTTTGTGATTTATTGTGCCTAAATGCTTTTCAGTCTAAGGCCCTAAAAACATTCAGGTTATACATTTTCGCTATAGTGATTAAACTTTGCACTGCAGTGCATCCACAAAGCACATTGTGTTCTGAATAGCTGCTCTGGTCAATTATGACTTGAGATTCCTGTGATGTGATTTTTACAGATGCGCACATTACAATGTCAATGCTGAAACAATATACTGGGCAGCCCTAATGTAGTCTGTATGTAGTGTATCTGATGGTTCTGATGTTAAAGGTTATGATGGAATGGATCTGGGCCGGATCCTGAAGGACATCGAGGTCAGTGAGGAGGGGCCGATGGACCGCTGGAGCATACAGGTGACTCTGGAGGACAGTCAGGAGAGAGGAGACCCTGTGCCCTA[C/A]GAAATCATCAACAACTATTTCTCCATCGGAGTGGTGAGACTCGTAGAGTACTTAAATCTTTACAATCTGTTTTAATATAATGGGGTATTTATTTAAGCTGTATGTTAGAGTGGGTTTACGATTCTCACTGTACTGAATGTGTCTTGAACAGGATGCCTCCATTGCTCATCGCTTTCACACAATGAGGGAGAAACATCCACAAAAGTTTAACAGCAGGTAGGTAATGTTTTAGATCAGTGTTTCTCAGCCACATTCCCGGAGGAACACCAGCTCTGTGTATTTTTCTTGTCTCCTTGATCAAACACACCTAATTCAGATCATCAGCTCACTAGCAGAGACAAAGGCTGTTTCTCAATTCCAAGAACACAGAGAACAGACTCGTGATCTCGTGAAGACTGTTCTTGCCAGGTTACCAAAAATCGAACAGAGACAAAAGTACAACCCAATAAACAAAAGTGAATCAAACAAAGTTAGAATAGGAATTCAAAAATATGATCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45808
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085642 Nonsense 651 727 22 24
ENSDART00000134883 Nonsense 600 676 19 21
ENSDART00000143013 None None 90 None 3
Genomic Location (Zv9):
Chromosome 23 (position 32480672)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32315562
GRCz11 23 32242093
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAAAACACTTAACCAACTGTCTCTGAACAGATATGAGTGATAAACGAT[T/A]GGAAGTGGTGGGACTGGAAGGAGCCATGGAGATGGGACAGATTTACACCG
Long Flanking Sequence:
CAACTAAAAAGCAAGAGCGCAGTGAGGGCATTAGAGTGATAACACCTGTTACTATTAACCTGCTTCTGGTATTAGAGCTCAAACCGAGCCCATTTCAATCTACCAGATCAGGGACATTCATTCACAAAATGAAGTTCATTACTTAAAAATAAGCGCTTTGTTCAGCCTGAAATAATTGAAAAGCACAACAGGACTGACCTCTGCAACTCTCTCTGGCCTAATGCAGTGTTGTGGGACTCAGCTGGATCTGAGTAGTCTTTCTCTGGAGGGCATCGCCATCCTCAACATTCCCAGCATGCACGGCGGCTCCAACCTCTGGGGTGAGGCAAAAAAAAGTGACCGAATGGACCAAAAGTTGCCCGAGGTCATAGTAGATCCTGAAATCTTAAAAGTGAGCCCACAAGGTAGGTTTCTTTCCATGTGGAGACAAAGTTTTAATATAAAAGTTATCCAAAAACACTTAACCAACTGTCTCTGAACAGATATGAGTGATAAACGAT[T/A]GGAAGTGGTGGGACTGGAAGGAGCCATGGAGATGGGACAGATTTACACCGGCTTAAAGAGTGCAGTCAGACTTGCCAAAACATCTCAGATTACCATCAGGTGAGACGATCGCTTGCAAACAAATGGGTGAAAATGACATGCTCGGACATGCCTGTGTGCATTTGCATAGCTGTTCGCATTTTATTCAGAAGGTTAGAATATTCCATTTGCAACCCACTCATTCTTTTGTCATTAAAAAAGGGCGATGGCCTGTTTGTTTTGTCAGAATTCTATGTAATATAATGTTAATACATTATAATTGTATAAATGTAAAATTGAAAAAAAATGTTTATGTATAGGACAAAGAAGCCTTTGCCCATGCAGATTGATGGAGAGCCGTGGATGCAGCCACCTTGTACTGTAAGTGTCCATTATGTACACAATACTGCTTTTTTAAACCATAGAGTGAAGATTTTGATTCATATGTTGTTGTTTTTTTGTTCAGATTCATAAATTAAGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29974
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085642 Essential Splice Site 705 727 24 24
ENSDART00000134883 Essential Splice Site 654 676 21 21
ENSDART00000143013 None None 90 None 3
Genomic Location (Zv9):
Chromosome 23 (position 32478926)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32313816
GRCz11 23 32240347
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTATTATTATTTAACTTAATGTGTTGTTTTATGTATTTCTGTTTTTCA[G/T]ATTCACATCACACATAAGAACCAAGCCAGTATGCTGATGGGCCCTCAAGC
Long Flanking Sequence:
GTATGTTGTGGAAGGGCATTCGCTGCGTAAAACATGTGCTGGAATAGTCATTTCGCTGTGGTGACCCCTGATAAATCAAGGACTAAGCCTAAGAAAAATAAATAAATAACTGAATGTGTACGGTGCTTTAAATTGCTAACAATTATATTATATTGTTACACATCCATCACCAAATTATCCATAATTTATTAATTCTCTCCAATTCTTCTTGCGTCCCTTCTTAAAATATCTGTGATCAATACTAAATTTGTAGATAACTCACAGCAAGTTAGGCATAAAAAACCAACGTTGTTCCAAAAGGAGTCAGAATACTTTACCTAAAATGACTGCTTTAGAAGATGTTATTTACTACAGTTTTCCTACTGTACTAATGTAATTTACAGCGTCAGTTTATTTCCCTAGTACTTCTGCTAATAAAAGCAGACCTTTTAACTTCAATTTCAGCTTATTTACTATTATTATTTAACTTAATGTGTTGTTTTATGTATTTCTGTTTTTCA[G/T]ATTCACATCACACATAAGAACCAAGCCAGTATGCTGATGGGCCCTCAAGCCAAATCTGGCTTTTTCAAATAGATTTACCTACGCATGAGGATGATCCAGTTCGCTTCAAAACTCTGTGTGCATTAAAAGGACTGAAGGCAATGACAGTTTATGTACATTTTGCAAAAGAAGATGCTTAATAAGGTTTTAGCTCTTACCGAAATCCTTGTGTGTTTTTAGGAGATGATTCTTACATGAGGTACAAACTCTTCGCTGATATCCAATATGCTTTCTTTTTAAGAAACTAGTGTGCTCAAACTGTAGGTCATGCATTTTTTGCGTGCATTTTTTTTTAGCTGTGATACACATATCATGTGCACAGGTCATTCCAAATAAATAGCTTGTTTTAAGGTTATGTAGGTGTACATAAAATAAGCTTCAAGTGTATGAATCGAGGTTTGATGCAGAGTTATTTTGCTGTATAGTGGATTTCAAAACAAGAAGCAGATCTGTAATAATTC
Associated Phenotype:
Not determined