Busch Lab

ZMP

ipo13

Ensembl ID:
ENSDARG00000060618
ZFIN ID:
ZDB-GENE-070706-1
Human Orthologue:
IPO13
Human Description:
importin 13 [Source:HGNC Symbol;Acc:16853]
Mouse Orthologue:
Ipo13
Mouse Description:
importin 13 Gene [Source:MGI Symbol;Acc:MGI:2385205]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23808 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4124
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085624 Essential Splice Site 563 946 10 21
Genomic Location (Zv9):
Chromosome 20 (position 48062175)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 47860310
GRCz11 20 48336497
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTCTCTCTCTCGTTTTTTTNAGGAAGTGCTTATTAAACAGAWCCACAAG[G/A]TGAGTTTATGTTTCCATTGTTGATTTTTCACTCTGATATAKCTAAATTTA
Long Flanking Sequence:
TCTCTCTCTCTCTCTCAAGTTCAAGTTGCTTTATTGGCATGACATTAAGTACAGTATTGCCAAAGCACTTCAAATATGAAATATAATAAAACCATTGAAAAATGAATAGTAATACAGATAAGATATAATGACACACACACAAAAAAACAATACATTTGATAAATATAATAATTTGAAAAAATGTAAATTATTTAAATAAGATACACAAATTTACATTAACCATTTCTTATGGTGTGTAGGGTGTATACATATTTTGCAGCTAGTCTAGATGTCAATTCGTCCTCTCCGAGTATATGGTAAAGTTTTTCTGAGTCATTTAAATTAAAAAATGAATTGATCAATGTTTCAAATTGGGGGAAAAAATATTTCTCTAGTCGTGGTGTATTTGGGGCAAAACAGAAGGAAGTGTGTTTCATCCTCTATTTTGTTTGTGTCACACTGTTTACCTAATCTCTCTCTCTCGTTTTTTTTAGGAAGTGCTTATTAAACAGATCCACAAG[G/A]TGAGTTTATGTTTCCATTGTTGATTTTTCACTCTGATATAGCTAAATTTATAGTTGATAAAGTATTAGCATTTAGCGCTCTGCTTCGGAATTGAAAAATCTATGCTGAAGCATGAACTTCCAATGAGCCTGTTGAAATCTGTTAATGGACACGTGAAATCAAAACTAACCATATTGATTTGGTTAGCTCACATTGCTAGTTTTGTGGTGAACAATTCATCTGTGTTTAAAAAATTGAACTGGAATGGAGGCTTCATGTCAGACCACTGTGTTCACCTGTTCCTGTGTTGGATGTGTATGTGTGTGTCTGCAGACCAGTCAGTGTATGTGGCTGATGCAGGCTCTGGGTTTCCTGCTGTCGGCGTTACCTGTGGAGGAGATCTTGAGGAACCTTCACTCTCTGATCACACCGTACATCCAGCAGCTGGAGAAACTGGCAGAGGAGACGGTGAGGATAATAAAAAATCAGATATTAAAACTATTATGTTTACCCTTATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23808
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085624 Essential Splice Site 854 946 19 21
Genomic Location (Zv9):
Chromosome 20 (position 48024221)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 47822356
GRCz11 20 48298701
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCGGGTGGTGCAGGAGGATGGAAAGCTCCTGCTAGTAGCTGTGCTGGAG[G/A]TGAGTGCACAAATTCAGCTGAAGTCTAGCACAGGAAACGATTAATAATGT
Long Flanking Sequence:
CCTATGAGCACACAAATGAGCGCTAATGCATTTGCTAATTAAACAGCATAGCGCAACGCCTCAAAACAACTCTTGCGCCAAGCTGAAACTACCAAAAGAATATTGTGCCGCGTCTTGCGCCACACTGCGCCGGGTGTATGATAGGGCCCATTATGTTTAGAAATGTGCTAAAAATCTAAACAGCACTTTTAGTAAACATTTGAAAAGAACACAAAGTTTTACAGAAGGGATTCATTAAATTAATTTAAATTAATTAATTAATTTAAAAGTTCACTGCCTTACAGTTTTTGATTAAAAGGGCAAGATGAAATGCTCTTAGTGAGTGGAGTTCAGTTTGTTTCTCTGTTTCCATCCTGTAAATCTCTTGATAAATGCTGTGTGGTGTTTCTTCATGTTGTCCTTCACCTCAGTCCGAGCTGATCCCGCACTGCGCAGACATTCCTCCTCTGGCTCGGGTGGTGCAGGAGGATGGAAAGCTCCTGCTAGTAGCTGTGCTGGAG[G/A]TGAGTGCACAAATTCAGCTGAAGTCTAGCACAGGAAACGATTAATAATGTATCTGTTCGAACAAAAATGATCAGCCAACATGTTTGGTTTCTTAGCCGGGTGAGAAAAATGGCCAAAAAATAAAGCTGACAAATCGTTAAAGGTCCCGTGAAGTGTTTAATGTGCATTTTTGTTCGATTTTTGCTGTAATCTCAACTGAAATACGAAAAGAGGGTATGGCATAGAGTAGCTCCTCCTCTTTTTAAAAACAGCCAATAGCGTCTTGTTTTTATCACAGCTCTGCCAGTGAGAGTGGTTGAGCTCAAGAGCATCAAATTAAAAGCAAATGAGAAGCATCTTGAACAGGGTTGGGCATTTCAGACACTATAAAGCATTTGATTGGTCAGAAGATTCAATGAGAAACTGAAGTATGAGGTAATGGTATTGTTGATCTTTTTAGGCGGAAGTGACCAACTGCATGCTTTAGATGTTTATATCAGGGTTTTTATCTTCTAAACACA
Associated Phenotype:
Not determined