Busch Lab

ZMP

si:dkey-104n16.1

Ensembl ID:
ENSDARG00000060610
ZFIN ID:
ZDB-GENE-081104-299
Description:
Novel protocadherin protein [Source:UniProtKB/TrEMBL;Acc:B0UX50]
Human Orthologue:
PCDH7
Human Description:
protocadherin 7 [Source:HGNC Symbol;Acc:8659]
Mouse Orthologue:
Pcdh7
Mouse Description:
protocadherin 7 Gene [Source:MGI Symbol;Acc:MGI:1860487]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa14558 Nonsense Available for shipment Available now
sa9185 Nonsense Mutation detected in F1 DNA Not yet available
sa2374 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa14558
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085612 Nonsense 347 1101 1 2

The following transcripts of ENSDARG00000060610 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 64102254)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 63016695
GRCz11 7 63326857
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCTTGATGAGAGCACTGGCTGGCTCAGTGTTTTGCACCGAATTGATCGT[G/T]AAGATGTGAGCCAGCTTCGTTTCACAGTCATGGCACGTGACCGTGGTCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8293
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085612 Nonsense 431 1101 1 2

The following transcripts of ENSDARG00000060610 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 64102508)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 63016949
GRCz11 7 63327111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTYGTSCAAGTGTCAGACAGAGATAAAGGACCAAACGGTATAGTGACATG[C/A]ACTGTAGTGGGTGAWGTWCCTTTTCAGCTGAAACCTGCCAGCGAGGTCGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7097
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085612 Nonsense 508 1101 1 2

The following transcripts of ENSDARG00000060610 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 64102737)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 63017178
GRCz11 7 63327340
KASP Assay ID:
554-4891.1 (used for ordering genotyping assays)
KASP Sequence:
CACTAAYAGTGAAGGTGGGGGACATGAATGACAATCCACCAGTTTTTAGY[A/T]AARGCACAGTGGAGGTTTCATTTCCTGAAAACAATGCTCCCGGTGAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9185
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085612 Nonsense 676 1101 1 2

The following transcripts of ENSDARG00000060610 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 64103241)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 63017682
GRCz11 7 63327844
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAACAACACAGGTACCATTTTCTCAAACATGGCTTTTGATCGTGAGCAA[A/T]GAAACAATTATTCATTCCGTGTCAAAGCTGTTGATGGTGGCGATCCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2374
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085612 Nonsense 1051 1101 2 2

The following transcripts of ENSDARG00000060610 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 64233535)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 63147976
GRCz11 7 63458138
KASP Assay ID:
554-3085.1 (used for ordering genotyping assays)
KASP Sequence:
TGACCTTCTCGGTGGTGAGCCAACCCCAGGACCCGCACCAGGGCTCGCTG[C/T]AGAGTTGCTACGACAGTGGCYTGGAGGAGTCGGAGACGCCCAGCAGCAAG
Associated Phenotype:
Not determined