Busch Lab

ZMP

rgs7bpa

Ensembl ID:
ENSDARG00000060601
ZFIN ID:
ZDB-GENE-060929-380
Description:
Regulator of G-protein signaling 7-binding protein A [Source:UniProtKB/Swiss-Prot;Acc:Q08BU8]
Human Orthologue:
RGS7BP
Human Description:
regulator of G-protein signaling 7 binding protein [Source:HGNC Symbol;Acc:23271]
Mouse Orthologue:
Rgs7bp
Mouse Description:
regulator of G-protein signalling 7 binding protein Gene [Source:MGI Symbol;Acc:MGI:106334]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa21336 Essential Splice Site Available for shipment Available now
sa31663 Nonsense Available for shipment Available now
sa1911 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21336
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085573 Essential Splice Site 48 248 None 6

The following transcripts of ENSDARG00000060601 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 32762614)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31905340
GRCz11 8 31914572
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGCCTGTACTTTCTTAGCTTGTTTGCCTTTGTTTTCCTCTCTTCCAAA[A/G]GGTTGTCCAGGAGTTCAATACACTTGTGGCCCTCTATAGGGAGTTGGTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5489
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085573 Nonsense 136 248 3 6

The following transcripts of ENSDARG00000060601 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 32758408)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31901134
GRCz11 8 31910366
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCAGTGCTGTCTGGAGATGTACCTGACGGAGATGCTGAAATCTGTGTG[T/A]CTGCTGGGGTCCCTGCAGCTACACAGGAAAGGTAATGCTGCGAGGAYGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31663
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085573 Nonsense 213 248 5 6

The following transcripts of ENSDARG00000060601 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 32754796)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31897522
GRCz11 8 31906754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGACAGAAATGAAAAATCTGCTAAGCAAACTCAGGGAGACAATGCCTT[T/A]ACCGCTGAAGAACCAAGGTAATGTTCACTTACACAAGTTCCCTCGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1911
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085573 Essential Splice Site 219 248 5 6

The following transcripts of ENSDARG00000060601 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 32754777)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31897503
GRCz11 8 31906735
KASP Assay ID:
554-1901.1 (used for ordering genotyping assays)
KASP Sequence:
CTGCTAAGCAAACTCAGGGAGACAATGCCTTTACCGCTGAAGAACCAAGG[T/C]AATGTTCACTTACACAAGTTCSCTCGCTGATATTACAGACTAATTCACTG
Associated Phenotype:
Not determined