Busch Lab

ZMP

SOLH

Ensembl ID:
ENSDARG00000060600
Description:
small optic lobes homolog (Drosophila) [Source:HGNC Symbol;Acc:11182]
Human Orthologue:
SOLH
Human Description:
small optic lobes homolog (Drosophila) [Source:HGNC Symbol;Acc:11182]
Mouse Orthologue:
Solh
Mouse Description:
small optic lobes homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1355075]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa19352 Nonsense Mutation detected in F1 DNA Not yet available
sa8803 Nonsense Mutation detected in F1 DNA Not yet available
sa14132 Nonsense Available for shipment Available now
sa44189 Nonsense Mutation detected in F1 DNA Not yet available
sa37958 Nonsense Mutation detected in F1 DNA Not yet available
sa19353 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30147
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085565 Essential Splice Site 32 1122 1 12
Genomic Location (Zv9):
Chromosome 24 (position 40607581)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39139813
GRCz11 24 39027576
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGAAGAAGAGAAGCTCGGTCCATCCAAAGGTCTGCCCGTGCTCCACAA[G/A]TAAGATCACTTTTCTAAACACGTATATAATAGATCATAATATCATAACAC
Long Flanking Sequence:
GATTGATGATTCTGGGCCGCAGAGCGCCCTCTGTAGGCAAATAACCATGCGTTTTCCAGGAACACCATCAAGCCGGTAACATTTGCGGTCCAATGAGAATTTACCTTTCTGTTCAGTCCACACAAGGCATTTTGGGAAATGAGTTTCAGAAATCCGCATTCTGAACGCGAGTTACGCCATTAAACCAGCGCAGCGCCACGACAGACCGCGGATGTACGCCGACTGCGCGCTGATCTGTTTCTTGTGATTATTTCCATAGAGGAGCATGAGGAACCCTGCGAGATTAAAGCTGTAGATCAAACCAGCCAGATCACACATCAGCACATCCACAAAAGAGCATGGATCGGCGGAAAAAGAAGCTCGTTGAGAGTAAGAACGCGTTTTTATGACGGCTTTTGCGTTTACATGGCTAATTCAGGACCGCAGAAGGGAAAGTTAAAAGGGCAAATCAAGGAAGAAGAGAAGCTCGGTCCATCCAAAGGTCTGCCCGTGCTCCACAA[G/A]TAAGATCACTTTTCTAAACACGTATATAATAGATCATAATATCATAACACACATCACGTGCCACGCTGGGGGTTATTTGACGTAAATGTGTGTGTTTCTGTCTCTTTAATTGCTCAGCCTCATCAAATGTTACATTGTATCTTTTCAACTTCCTTGCCGTCGGCGAAGTGATACAATGTATCATTCTGTGGGAAAAGAACTCGTTCTGAAAGCCCTGCTTCAGTGATGCTTCTGAAGTAGGAAGTGAAGTCTGACATTTGGAGTTCAGCTATCATTAATAATGAGCAGCGTTTAAAATATTCCAAACAAAAATATTACACTGTGGAGCTGTATTATTGTGTATATGAACAACATCTGTTATAGGAATAACTTCGAAAATGATCATCTTTATGAATAATAGACTCTTCATTAATTCTTCATTCAGCCTGGTTGACTTGTTGATGTTTTTTTCCATCAGTTGATGATCAAATATTATTAAAGTAGAATTTTAGTAGAATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19352
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085565 Nonsense 49 1122 2 12
ENSDART00000085565 Nonsense 49 1122 2 12
Genomic Location (Zv9):
Chromosome 24 (position 40631008)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39163240
GRCz11 24 39051003
KASP Assay ID:
554-6219.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTCTCATTCACCTGGTTCGATGGAAGCAGTTGTGAGGAATTCTGATTG[G/A]TCCTGCGGGCGCTGCACGTTCCTCAACTCCAGCGGCTCTATGCGCTGCTC
Long Flanking Sequence:
CAGAACAGAAATTGGGGGGAAAAAATAAACGGGCTAATAATTCTGACTTCAACTGTACATTTCGCATTCTTTTAATTAATTTCAATTATTATTATTATTATAATACACCAAATATTTGATTTAAATTTTTTTATTAGGTGTAATCATACAAATAATTATGTATAATATATAAATAATTAACAATATTAATAACTATTAATTTATCTATTTACCTGTATTTTTTCTCCTTTTAGTTGTCGTGATATAACTTTATAAATGACATAAAACAATCCAATAATTTTTCAAATGTAAATTATAATTAAAATATAAAAAATTATTCATATTAATCTTCCTTAATCCCATGTATTTTCCTCCTCTCTCTTTGTGACCTCTGTTTTGTGTACATGTTTAAGTCTTAATATCCAGTCTGAAATCCATATCTAATTGTCTCCTCTTTCTCTCTCTCTCAGTCATTCTCATTCACCTGGTTCGATGGAAGCAGTTGTGAGGAATTCTGATTG[G/A]TCCTGCGGGCGCTGCACGTTCCTCAACTCCAGCGGCTCTATGCGCTGCTCCATTTGTGAAGCTCCCCGACAGAAGCCGGATCTGAACCACATTCTGCGCCTCAGCAGTGCAGAGGAACCCCGCTGGTCCTGCCCACGCTGCACTCTCACCAACCACCACGGGTTAGGCTCCTGTTCTGTGTGTGGAGCTGCTCCGGTAACACCCAACGGACCCCTCCCACCCAAACAAACCCCGCCCACTCCGATTGACCTCGCCTCTAGCCCTGAACCTAAAGGTCAGGTGGCGAATGGGGAATCCCAGTGCATAGAGTCCAATGGGGAGGTGCCTATGAGTGGGCAGGGCTCCTCAGAGTGGGCGTGTCCTCGTTGTACTTTAGTGAATACTCCAGTTGCGTTGTCGTGTTCAGCGTGTGGTGGTCCGAGGAAACTTTCCTTACCGAAAATCCCTCCGGAGGCTCTAGTGGTACCAGAAGTGCGCACACCTGTGGCAGGGTTTCCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8803
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085565 Nonsense 49 1122 2 12
ENSDART00000085565 Nonsense 49 1122 2 12
Genomic Location (Zv9):
Chromosome 24 (position 40631008)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39163240
GRCz11 24 39051003
KASP Assay ID:
554-6219.1 (used for ordering genotyping assays)
KASP Sequence:
CATTCTCATTCACCTGGTTCGATGGAAGCAGTTGTGAGGAATTCTGATTG[G/A]TCCTGCGGGCGCTGCACGTTCCTCAACTCCAGCGGCTCYATGCGCTGCTC
Long Flanking Sequence:
CAGAACAGAAATTGGGGGGAAAAAATAAACGGGCTAATAATTCTGACTTCAACTGTACATTTCGCATTCTTTTAATTAATTTCAATTATTATTATTATTATAATACACCAAATATTTGATTTAAATTTTTTTATTAGGTGTAATCATACAAATAATTATGTATAATATATAAATAATTAACAATATTAATAACTATTAATTTATCTATTTACCTGTATTTTTTCTCCTTTTAGTTGTCGTGATATAACTTTATAAATGACATAAAACAATCCAATAATTTTTCAAATGTAAATTATAATTAAAATATAAAAAATTATTCATATTAATCTTCCTTAATCCCATGTATTTTCCTCCTCTCTCTTTGTGACCTCTGTTTTGTGTACATGTTTAAGTCTTAATATCCAGTCTGAAATCCATATCTAATTGTCTCCTCTTTCTCTCTCTCTCAGTCATTCTCATTCACCTGGTTCGATGGAAGCAGTTGTGAGGAATTCTGATTG[G/A]TCCTGCGGGCGCTGCACGTTCCTCAACTCCAGCGGCTCTATGCGCTGCTCCATTTGTGAAGCTCCCCGACAGAAGCCGGATCTGAACCACATTCTGCGCCTCAGCAGTGCAGAGGAACCCCGCTGGTCCTGCCCACGCTGCACTCTCACCAACCACCACGGGTTAGGCTCCTGTTCTGTGTGTGGAGCTGCTCCGGTAACACCCAACGGACCCCTCCCACCCAAACAAACCCCGCCCACTCCGATTGACCTCGCCTCTAGCCCTGAACCTAAAGGTCAGGTGGCGAATGGGGAATCCCAGTGCATAGAGTCCAATGGGGAGGTGCCTATGAGTGGGCAGGGCTCCTCAGAGTGGGCGTGTCCTCGTTGTACTTTAGTGAATACTCCAGTTGCGTTGTCGTGTTCAGCGTGTGGTGGTCCGAGGAAACTTTCCTTACCGAAAATCCCTCCGGAGGCTCTAGTGGTACCAGAAGTGCGCACACCTGTGGCAGGGTTTCCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14132
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085565 Nonsense 253 1122 2 12
Genomic Location (Zv9):
Chromosome 24 (position 40631619)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39163851
GRCz11 24 39051614
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCACCRTCTGAAACCCCATCTCCACCCCCTGTCCCRTTTCTGCCCCCYT[C/A]GTTGTCCKCACTTCAAAATAATCCTGTGCCTCGCAGCCGAAGAGAAGTYC
Long Flanking Sequence:
AGAGGAACCCCGCTGGTCCTGCCCACGCTGCACTCTCACCAACCACCACGGGTTAGGCTCCTGTTCTGTGTGTGGAGCTGCTCCGGTAACACCCAACGGACCCCTCCCACCCAAACAAACCCCGCCCACTCCGATTGACCTCGCCTCTAGCCCTGAACCTAAAGGTCAGGTGGCGAATGGGGAATCCCAGTGCATAGAGTCCAATGGGGAGGTGCCTATGAGTGGGCAGGGCTCCTCAGAGTGGGCGTGTCCTCGTTGTACTTTAGTGAATACTCCAGTTGCGTTGTCGTGTTCAGCGTGTGGTGGTCCGAGGAAACTTTCCTTACCGAAAATCCCTCCGGAGGCTCTAGTGGTACCAGAAGTGCGCACACCTGTGGCAGGGTTTCCTACGCAAACGGCAGGAGCATCTGCACCTCTTCTTATCGATCTAACCGAAGATTCTCCACCGCAGGCACCGTCTGAAACCCCATCTCCACCCCCTGTCCCGTTTCTGCCCCCTT[C/A]GTTGTCCTCACTTCAAAATAATCCTGTGCCTCGCAGCCGAAGAGAAGTCCCGCCCCCTGGGCGGCCTCCAAACCCTGGCCCCTCACCAACCTCACCTTCATCCTGCCCACCAACCAAGCCTAAACCCCTCCCACCATCAGGTAATTACCCAGTCAAGCGCCTCAGCGTGCTGGAGGAGGAGGAGCCTAATAACCCCACCCCTCCAGTCACATCTCCGCCTTCCTGGAAGTGCCCCGGATGCTCCGCCCCAACAGCTCCTCCTTCATCGTCTGCCGGGCGCTGCGATGCATGCAGAGGGTCGAGGCCGGGTTCGGGTGGTGATGTCATCGATGTGCTCGGCGAATCAGTGCGTTTCACGCCAGCGTCGCCATCCAGCCCAGACTTCAGCTCCTGGGCGTGCTCCAAATGTACGCTGCGCAACCCGACGGGCGCGGGTCACTGTACGGCCTGCGGATCCTCCAAACTGCATGGTTTCTCGGAGCCGTCCAGCTGCTCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44189
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085565 Nonsense 453 1122 2 12
Genomic Location (Zv9):
Chromosome 24 (position 40632218)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39164450
GRCz11 24 39052213
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCCTCGTCCTCCATTTCGTCCCCGTCGGCGCAGGACAAGAGTGTGTGC[C/T]AGTGGACGTGTCCTGCCTGCACGCTGCTGAACGAGGGAAGGATGAAGCAC
Long Flanking Sequence:
CATCCTGCCCACCAACCAAGCCTAAACCCCTCCCACCATCAGGTAATTACCCAGTCAAGCGCCTCAGCGTGCTGGAGGAGGAGGAGCCTAATAACCCCACCCCTCCAGTCACATCTCCGCCTTCCTGGAAGTGCCCCGGATGCTCCGCCCCAACAGCTCCTCCTTCATCGTCTGCCGGGCGCTGCGATGCATGCAGAGGGTCGAGGCCGGGTTCGGGTGGTGATGTCATCGATGTGCTCGGCGAATCAGTGCGTTTCACGCCAGCGTCGCCATCCAGCCCAGACTTCAGCTCCTGGGCGTGCTCCAAATGTACGCTGCGCAACCCGACGGGCGCGGGTCACTGTACGGCCTGCGGATCCTCCAAACTGCATGGTTTCTCGGAGCCGTCCAGCTGCTCATCATGCTCTCGGAAACAACCGCACTCCCACCCGCGTGCCTTTACCTCCACCTCCTCCTCGTCCTCCATTTCGTCCCCGTCGGCGCAGGACAAGAGTGTGTGC[C/T]AGTGGACGTGTCCTGCCTGCACGCTGCTGAACGAGGGAAGGATGAAGCACTGCGCCGCATGTCACACGCCGCAGCAGTACCTGAATCTGAGGAAAACCGGGAAGCCGCTCAAGCGCAGGGAGAGCATGCATGTGGAGGCCCGCAGGCGCACGGATGAGGGAGAGGCCAAGGAATTGTGGGAAAATATCGTCAGCTTCTGTAGGGAGGTAAGATTCTGTCACTTTCATTGACACAAAAAGGAATGTACGGTAACACTTTATAATAACTACACACTATCAATCATTTATTAAGCATTAGCAAATAGTGAATTCATTATCCGTTAAGCATTAACTCTACATTAATAAACGTTAGTAAGCAGTTTATAACTGCAGCTACAAATGCTCCATTCTTGACTTATAACCACATTTAAAATGTGCTTAATTATTGTATTTTCATACTTGGTAAATAATTTATTTTTCATTACTAAATTAAGTATCGCATTATTTACAAACCAGTTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37958
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085565 Nonsense 571 1122 3 12
Genomic Location (Zv9):
Chromosome 24 (position 40641819)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39174051
GRCz11 24 39061814
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTCCTCATGAGATCAACTGCAATAACTTTAAGGATCGCGGTGTGAAGTG[G/A]TCTGTGTTCAGGACACCCCGTCCCTCAGATATTCTGCAAGGCCTTCTGGG
Long Flanking Sequence:
GAAACCCACGCCAACACGGGGAGAACATGCAAACGCCAAACAGAAATGCCAGCTGACCTAGCTGAGGCTCGAACCAATCTTCTTGCTGTGATGGGACAGTGCTAACCACTGAGCCACCATGTCACCCATTATTTTGCAGCATATTTATTCAAAATATTTCACGATTTCATATATTCACGTGTGCATGTGATATCTTAATGGGCAAATAAGATCTATTTAATACAGATAAAACTTTTGCAACCGATTCCTATTTAAAAATATACCATTTTAGATTAAAATGATGCACACATTATTTTTAAATTTACATCTGTGTGTGAGATATCTTACAGTGCTGTGGTGTGTTTGTTGCAGAACGCAGTGAATTTCGTGGATGACAGTTTTCCTCCTGGTCCTCGATCGGTCGGTTTCCCGGAAAACGACAGCGTCCAGCAGCGGATCAAGAAGTGGCTCCGTCCTCATGAGATCAACTGCAATAACTTTAAGGATCGCGGTGTGAAGTG[G/A]TCTGTGTTCAGGACACCCCGTCCCTCAGATATTCTGCAAGGCCTTCTGGGAAACTGCTGGTAAGAGAAGAGCTCCATATAAAGCACTGCACCGTATATTACATACAGTAGCATATACAGTAATATGAACAGTATGCGAGTCAGCATGTTTAAAGGGACAGTTCACCCTAAAATGAGAATTCTGTCCTCATTTACTTGCTCTTTATTTGTTTCAAAGTCAAACCTGTATGAGTTTTGAACACAAAAGAAGATATTTCGAAGAATGCTGAAAATAGAGAAAGTTGGATGTTTTAATCGTCATTTATAAATGACACTAAGAAAATTTCATTTTTAAAAACACTAATGACATTTAACCTGTACAATAAAATTTTAGTAATGTCACATGACATCTTTAGCCAACTGAACTAAAAGATAGTGGCCATTAGCTTTACATAATTAGAAAACACAAACTAAATGAGACACCAGCACACATTAGGTGACATGCTCTCACAGCAAGATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19353
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085565 Nonsense 645 1122 4 12
Genomic Location (Zv9):
Chromosome 24 (position 40644770)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39177002
GRCz11 24 39064765
KASP Assay ID:
554-6220.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCATGTGGACCACCGTTTTAGTGGACGACATGCTGCCCTGTGACGAATA[C/A]GGCTTTCTGCTCTTCTCGCAGGTTTGTTCTGCTGTAGTTTCTTAAAGGTC
Long Flanking Sequence:
GCATTTTCCCATTAGCTAAGAAACTTTCCATAGTCGTCTGTTTCTCTCTCATTTTGCTGCATGTGGGTTTAATTTGGGAGACCAACTGACCGAGATGTAAGCAAGTGAATATGCTCATTTTTTAAAATAAAAGATTTTTCAATATAAAAGATTGTTTAGACTTTAAAGATTATAAATAAAACGGAAATAATTAATGCTTTCTTGTGCGGCCAGATACCAATTGATCCACCTGATGGTTGAGGACCACTGGTTTAGACAATCTCTAGCATTGAGTTGATCTGTATTGTTGTTCACAGAGTCTTGATTTGTTTTTGAATTGTTCATGCTGTATTTTTCAGGTTTCTGAGTGCGCTGGCGGTGTTGGCGGAGCGGCCGGAGTTGGTGGAGCGAGTGATGATCACCAGAAGCATCTGTCAGGAAGGAGCCTATCAGGTCCGGCTCTGTAAAGACGGCATGTGGACCACCGTTTTAGTGGACGACATGCTGCCCTGTGACGAATA[C/A]GGCTTTCTGCTCTTCTCGCAGGTTTGTTCTGCTGTAGTTTCTTAAAGGTCTCGTGAAGTGCTTTGAAAGGTGCACTTTTTATTACCTTTAAAGAGATTGTGATTTAGTTTGATGCCTAATCTGCTTTTGATTGTTTAAATTAAACTGAACTGAATGATATTAAAGTGATGTTTGCACCACATCTGCACTTTGAAATCTCAGCAACAGCTGGAGGTTTGTAGTCCACAGCATGTTACTGCAATGTTTACAGTGCTGATCCTATACTCCTGGGTTTCTTCCCACCACAGTTTTGTTTTAAAATGGCGGCCACGTGAAATAAGCATATAGATGTCCCTAAAACTAACAGACTGAAACTAACTGAAAAACTTTAGTTTAATTTCACAGGACATTTAAAGTTTGTGTGAATCAAAAGTTGCTAAGACTTTATATGTCATAATATGAAAGGTATTTCTTTCTAATGTTAGGATCATTTTAGAAAAAGTCACCAAACGTCAAGATAA
Associated Phenotype:
Not determined