Busch Lab

ZMP

SRCRB4D (1 of 2)

Ensembl ID:
ENSDARG00000060592
Description:
scavenger receptor cysteine rich domain containing, group B (4 domains) [Source:HGNC Symbol;Acc:1446
Human Orthologue:
SRCRB4D
Human Description:
scavenger receptor cysteine rich domain containing, group B (4 domains) [Source:HGNC Symbol;Acc:1446
Mouse Orthologue:
Srcrb4d
Mouse Description:
scavenger receptor cysteine rich domain containing, group B (4 domains) Gene [Source:MGI Symbol;Acc:

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11521 Splice Site, Nonsense Available for shipment Available now
sa14638 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11521
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085542 Splice Site, Nonsense 114 612 2 13
Genomic Location (Zv9):
Chromosome 5 (position 3491298)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 3144961
GRCz11 5 3474693
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
RGGATAKTATGCAAGGCAACATGCTCTTATTGAACGTTGAANTTCTTGCT[C/T]GTTTTTATGTTTAATGTACATTCATGTACATTAAAAAMTGTTATTSCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14638
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085542 Nonsense 296 612 6 13
Genomic Location (Zv9):
Chromosome 5 (position 3495495)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 3149158
GRCz11 5 3478890
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTGGAGGTCTACTATCAGGGAAACTGGGGGACRGTGTGTGATGATGACT[G/A]GAGCATAGCAGATGCCAYAGTCGTGTGTCAACWGCTCAGCTGCGGGTCAG
Associated Phenotype:
Not determined