Busch Lab

ZMP

si:dkey-38k3.3

Ensembl ID:
ENSDARG00000060580
ZFIN ID:
ZDB-GENE-070424-242
Description:
threonine aspartase 1 [Source:RefSeq peptide;Acc:NP_001094423]
Human Orthologue:
TASP1
Human Description:
taspase, threonine aspartase, 1 [Source:HGNC Symbol;Acc:15859]
Mouse Orthologue:
Tasp1
Mouse Description:
taspase, threonine aspartase 1 Gene [Source:MGI Symbol;Acc:MGI:1923062]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22345 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4518
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085499 None None 409 None 13
ENSDART00000133661 Essential Splice Site None 409 1 14

The following transcripts of ENSDARG00000060580 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 34912816)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 34563861
GRCz11 13 34689867
KASP Assay ID:
554-3592.1 (used for ordering genotyping assays)
KASP Sequence:
CNNTGGAAATGTGCGCTCTTCTGTTGTTATGCACCTGAAGTCTTCACGCGAG[T/C]AAGTTTTCCTTGTTTTCATTCTGTCTTGTGGGATTGAAATGNNNAGTAGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22345
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085499 Essential Splice Site 129 409 4 13
ENSDART00000133661 Essential Splice Site 129 409 5 14

The following transcripts of ENSDARG00000060580 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 34919293)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 34570337
GRCz11 13 34696343
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCATGGATGGCAAATCCTTAAACTATGGAGCCGTTGGAGCCTTGAGTG[G/A]TGAGTGCATCTATAAACATTATTAAGGCTGCTTTGAGCTTGTCACAATGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28159
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085499 Nonsense 151 409 5 13
ENSDART00000133661 Nonsense 151 409 6 14

The following transcripts of ENSDARG00000060580 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 34920626)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 34571670
GRCz11 13 34697676
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGCTGGTATCCAGAAGACTATTAAGTGAAACTCAGAAGGGGAAGCTAT[C/A]AGCTGGCAGGATTCCTCCATGGTGAGCTTAGCTCTCTGATGTTGGCTTGA
Associated Phenotype:
Not determined