Busch Lab

ZMP

si:ch73-263b18.1

Ensembl ID:
ENSDARG00000060567
ZFIN ID:
ZDB-GENE-100922-231
Human Orthologue:
TRPM2
Human Description:
transient receptor potential cation channel, subfamily M, member 2 [Source:HGNC Symbol;Acc:12339]
Mouse Orthologue:
Trpm2
Mouse Description:
transient receptor potential cation channel, subfamily M, member 2 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa34783 Nonsense Mutation detected in F1 DNA Not yet available
sa38766 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21609 Nonsense Available for shipment Available now
sa34781 Nonsense Available for shipment Available now
sa34780 Nonsense Mutation detected in F1 DNA Not yet available
sa14804 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34783
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085351 Nonsense 8 1421 1 39
ENSDART00000136940 Nonsense 4 290 1 6
Genomic Location (Zv9):
Chromosome 9 (position 54745621)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53380699
GRCz11 9 52920206
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGACCCTTGTGCAAACACTCGCGGTGAGCACTGCTAAAGGCGGCCGATA[T/A]CTGTCTCTGTCTCCCTCTTTCCAGCGCTGCTCACTCGCCTCCTGGATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38766
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085351 Essential Splice Site 302 1421 None 39
ENSDART00000136940 None 290 290 None 6
Genomic Location (Zv9):
Chromosome 9 (position 54728895)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53363973
GRCz11 9 52903480
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATACCAGTGGTCTGTGTGGTTCTGGACGGCGGTCCGGGAACTCTAAATG[T/A]GAGTTTTTCAAGTCATCAGCTTTTTTTAAAACAGTATTTCTAGATTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21609
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085351 Nonsense 391 1421 8 39
ENSDART00000136940 None None 290 None 6
Genomic Location (Zv9):
Chromosome 9 (position 54616096)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53357307
GRCz11 9 52896814
KASP Assay ID:
2260-2600.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGATGCCTCATTTGCTCACAGTATTCCGCATCGATGAGGATAAAAACTA[T/A]GACGTGGATGTGGCCATTCTGCAGGCGCTGCTAAAAGGTATTGCTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34781
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085351 Nonsense 896 1421 22 39
ENSDART00000136940 None None 290 None 6
Genomic Location (Zv9):
Chromosome 9 (position 54489618)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53332605
GRCz11 9 52872112
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGACTTCATCATATTCTGCCTGCGATTAATGGCCATCTTCTCCATCAGT[C/T]GAACTCTGGGTCCCAAAATAATCATCGTCAGGAGAATGGTGGGTTTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34780
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085351 Nonsense 931 1421 23 39
ENSDART00000136940 None None 290 None 6
Genomic Location (Zv9):
Chromosome 9 (position 54488337)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53331324
GRCz11 9 52870831
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTCATGTTTCTGCTCAGTATCTGGGTTGTGGCGTACGGAGTAGCCAAA[C/T]AGGGCATTCTGATCGAAAACGAAGAGAGACTAAACTGGATCATCCGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14804
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085351 Nonsense 1388 1421 38 39
ENSDART00000136940 None None 290 None 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 54460882)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53304048
GRCz11 9 52843555
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGCGCAGGTGCTGGAGAGGATTCTGGGTAAAAAGTTAAATGAAAAGACC[A/T]AGACTCTTCTAAAAGCTGGAGAAGAGGTGAGCATGGYAAACGCAAAASAT
Associated Phenotype:
Not determined