Busch Lab

ZMP

ENSDARG00000060557

Ensembl ID:
ENSDARG00000060557
Human Orthologues:
KIF2A, KIF2B
Human Descriptions:
kinesin family member 2B [Source:HGNC Symbol;Acc:29443]
kinesin heavy chain member 2A [Source:HGNC Symbol;Acc:6318]
Mouse Orthologues:
Kif2a, Kif2b
Mouse Descriptions:
kinesin family member 2A Gene [Source:MGI Symbol;Acc:MGI:108390]
kinesin family member 2B Gene [Source:MGI Symbol;Acc:MGI:1920720]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa30527 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30527
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085358 Essential Splice Site 52 694 2 23
Genomic Location (Zv9):
Chromosome Zv9_NA534 (position 21253)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45533140
GRCz11 10 45379752
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGTGACGGTGGAGTGGATCGAGAATGGCGACACCAAAGGGAAGGAGG[T/C]GAAGCATGTTCATGTTCAGCTGTCCATCAGTCTCATTGCTGGAGCTCATG
Long Flanking Sequence:
GGCTCATAGCCCTGAACCTCTTAATATAAAAGTTCTTTTGGGCCGCTGTAACTTTGAAGATCTTTGCTTGAAGAGTTTATTCATTACAGCAAACACAATGAAGTGAGGCACAACCTGTGCTGAAATAATACGCTTCACTGATGTTCACTAATGTTTATTATCAGAAGTAATAGGCCAGATCTGGGCCAGAATAAAAGCAAACTGTGGCCCAGAATAGGGTCAGTTCCGGTTCATTTGGTTGAATTCTGGCTGATATGTGCTATTGCTATGGCTTAATTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCAGAGTGTGTCTGCAGCTCCGTCCTCCTCAGATCTGTCAGTAAGTCTCTGCCTTCTTCTTCCTCTTCAGGCCGGATCCACCAGGCCATGGTGACGTCTCTGAATGACCACAATGACAGTGTGACGGTGGAGTGGATCGAGAATGGCGACACCAAAGGGAAGGAGG[T/C]GAAGCATGTTCATGTTCAGCTGTCCATCAGTCTCATTGCTGGAGCTCATGCAGTGGTAGATGTAATATAGTGCACTGCGCTTCTGTTCTGTGTGCGCGGCTCTTAAAGTCTTACATTGCTAAAACAGTATTTCAGGTTTGAACCCTACAGCGCGATCACCACTTCATGAACACCGTTATTAAAATGACATGTTGGACTGAAGTGATCGACAGTGTGTGGTGCTCATGTGTAAGCGTGGTCTGTGTGTAATGAAGACAGATGTCCGGCTATAGATGAAGTCAAACATGTTCATTAAGTCAAAGAAAACAAGTTATGTGCCCTATTTTGTGAAAATAATCAAATATTCATTATTATAAATACAATAAAAGCATGTTTATGTTAATATAATAAAACATGGAGTTTACAAAACATGCTTTAGCCTAAAATTGACAGTAAATCAGCGCTAAATATCGGAACACATTATATTCCAGATTTACAGTTGACATCAGAAAACGAGCCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30526
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085358 Essential Splice Site 585 694 20 23
Genomic Location (Zv9):
Chromosome Zv9_NA534 (position 12548)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45524435
GRCz11 10 45371047
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGGAGCTCACCGCAGAGAGACGACCTCAAACTGCTCTGTGAACAAAAC[G/A]TAAGACACACACACACACACATATATATATATACAACTACAAATGCATAC
Long Flanking Sequence:
CTCCCTCCTCCTCTTCATAACCATGAGCATAACTCCGCCTTTCCCTCCTCCTCTTCATAACCATGAGTATGACTCCCCCTCTCCCTCCTCCTCTTCATAGCCATGAGCATGACTCCGCCTCTCCCTCCTCCTCTTCATAGCCATGAGCATGACTCCGCCTCTCCCTCCTCCTCTTCATAGCCATGAGCATGACTCCCGCAGGAGTGTTACCCTGAGCTTTGACTCTCGCAGTAGCCATCTCCCTTTTCCTACGTTGCTAATCATGTCTGTGTATGTGTGTTCGTGTTTCTATTTGTTTTTGTATATTTTAATAATGTGTGTGTGTATGTGTGTGTGTGTGTGTCTGTGTGTGTGTTTTGCGCAGAATGAAGGAGCTGGTTCTGGACCCTGGTGTGCTGCCAGAGAGTCGGGTCGGGTCTCAGTTGGAGGTTTTGGAGGCACAGTGGGGGATGGGGAGCTCACCGCAGAGAGACGACCTCAAACTGCTCTGTGAACAAAAC[G/A]TAAGACACACACACACACACATATATATATATACAACTACAAATGCATACACAGACACGCACACAGCTCTGTAATGCCGTTCTGTTCATGTGACTGACAGGAAGAGGAAGTGTCCCCGCAGCTCTTCACCTTCCATGAGGTGGTGTCTCAGCTGGTGGAGATGGAGGAGCAGGTGTTGGAGGACCACCGCGCCGTCTTCCAGGTTTGTTTGCGATGTTTATAAGTCTTTATTCAGACAGGATTAACATCACAGGTGGTGTAATTATTAGACATGACGAAAATCATCAAGCAGCCTCACACTAATCCAGAGTTTATAATAAAATCAACAGTATTCATGAGTGAAATGAAGTTTATACGACAGTAAACAGCGTAGCTTAGCACTTTCCTAATCATCAATAACTGTCTCTCTCACGCTAGTCGTATTTTATAAAGTTTATTTTAATTGCGTGCCCAAGTCATAAATAATTGTATCTTTAAATACATGACGGCCAAAATCATGA
Associated Phenotype:
Not determined