Busch Lab

ZMP

LOC565173

Ensembl ID:
ENSDARG00000060551
Human Orthologue:
RPS6KA5
Human Description:
ribosomal protein S6 kinase, 90kDa, polypeptide 5 [Source:HGNC Symbol;Acc:10434]
Mouse Orthologue:
Rps6ka5
Mouse Description:
ribosomal protein S6 kinase, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1920336]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa6491 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa28901 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23140 Nonsense Available for shipment Available now
sa36479 Essential Splice Site Available for shipment Available now
sa36478 Nonsense Mutation detected in F1 DNA Not yet available
sa15790 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6491
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Essential Splice Site 193 802 5 17
Genomic Location (Zv9):
Chromosome 17 (position 38597159)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38482056
GRCz11 17 38429641
KASP Assay ID:
554-4927.1 (used for ordering genotyping assays)
KASP Sequence:
AYGGTCACATTGTGTTGACGGATTTTGGTCTAAGTAAGGAATTTCATGAG[G/A]TAAGTTTGCTTGCAGAAATCTTTTGCAATTTTTAGTWACTGACAGCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28901
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Essential Splice Site 360 802 9 17
Genomic Location (Zv9):
Chromosome 17 (position 38583769)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38468666
GRCz11 17 38416251
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACATACTCGCCAGCAGCACTTCCAAACAACTGTGACCGCATCTTCCAGG[T/C]AGTGCAATTAATGGATAATATTATTGTGTAATATGAGTTGTGTAATGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23140
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Nonsense 362 802 10 17
Genomic Location (Zv9):
Chromosome 17 (position 38581821)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38466718
GRCz11 17 38414303
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTTTTCTGTTTGCCAGTGTGTTTATAGATGTTTGTGTCTGCAGGGCTA[T/G]TCCTTCATGGCTCCCTCTATCCTGTTCAAGAGGAACGCGGTGATGGATGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28900
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Essential Splice Site 402 802 10 17
ENSDART00000085438 Essential Splice Site 402 802 10 17
Genomic Location (Zv9):
Chromosome 17 (position 38581699)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38466596
GRCz11 17 38414181
KASP Assay ID:
2261-1382.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAGAAAGGCCGGGCTCTGCTGCTGTTGCCCGTAGCGCTATGATGAAGG[T/C]CAGTCTGCATAATCCTGTGTTGTAAGAAAAAACAAAACATTGCAACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36479
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Essential Splice Site 402 802 10 17
ENSDART00000085438 Essential Splice Site 402 802 10 17
Genomic Location (Zv9):
Chromosome 17 (position 38581699)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38466596
GRCz11 17 38414181
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAGAAAGGCCGGGCTCTGCTGCTGTTGCCCGTAGCGCTATGATGAAGG[T/C]CAGTCTGCATAATCCTGTGTTGTAAGAAAAAACAAAACATTGCAACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36478
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Nonsense 482 802 13 17
Genomic Location (Zv9):
Chromosome 17 (position 38569306)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38454203
GRCz11 17 38401788
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTAGACCCTCTAACGGGGTGATTTTCTGTTTGTTTAGCTGCACACATA[T/A]CTTGTCCTGGAACTCTTGCGAGGTGGTGAGCTTCTGGAGCGGATCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15790
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Nonsense 575 802 14 17
Genomic Location (Zv9):
Chromosome 17 (position 38567919)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38452816
GRCz11 17 38400401
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACCTCCTGACAATCAGCTCCTGAAGACCCCCTGCTTCACTCTTCAGTA[T/A]GCCGCACCAGAAATCCTCAAATACAGTGGTTAYGACGAGTCCTGCGACCT
Associated Phenotype:
Not determined