Busch Lab

ZMP

SHANK1 (1 of 3)

Ensembl ID:
ENSDARG00000060539
Description:
SH3 and multiple ankyrin repeat domains 1 [Source:HGNC Symbol;Acc:15474]
Human Orthologue:
SHANK1
Human Description:
SH3 and multiple ankyrin repeat domains 1 [Source:HGNC Symbol;Acc:15474]
Mouse Orthologue:
Shank1
Mouse Description:
SH3/ankyrin domain gene 1 Gene [Source:MGI Symbol;Acc:MGI:3613677]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa20034 Nonsense Available for shipment Available now
sa33198 Nonsense Mutation detected in F1 DNA Not yet available
sa40086 Nonsense Mutation detected in F1 DNA Not yet available
sa33197 Nonsense Mutation detected in F1 DNA Not yet available
sa40085 Nonsense Mutation detected in F1 DNA Not yet available
sa45142 Nonsense Mutation detected in F1 DNA Not yet available
sa20033 Nonsense Available for shipment Available now
sa40084 Nonsense Mutation detected in F1 DNA Not yet available
sa33196 Nonsense Mutation detected in F1 DNA Not yet available
sa12603 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20034
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 36 1695 1 33
Genomic Location (Zv9):
Chromosome 3 (position 30921246)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30639285
GRCz11 3 30770127
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGCAGTCTGACTGAGTCTCTGAGGGATGTTTTAAACTATGGTCTTTTT[C/T]AACCTGCCACTGACGGGCACGATGCCAAGTTCCTGGAGGAGGAGAGGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33198
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 183 1695 5 33
Genomic Location (Zv9):
Chromosome 3 (position 30909760)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30627799
GRCz11 3 30758641
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGTTCAAATTAAAATGTAATCCCGTGTCTTCTACTGTTCAGACGCTGT[T/A]GTCTTTGGGGGCGTCTTCTGATTATAAGGACAGCCGTGGGCTGACACCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26081
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 239 1695 6 33
Genomic Location (Zv9):
Chromosome 3 (position 30908205)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30626244
GRCz11 3 30757086
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATCAGCATCACTGATATTTTCATTGGTCTGTCTCTTTCTCCAGGCGTG[T/A]CAAAATGGGAACTCTCAACATTTAGAGCACCTGCTTTTTTATGGTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40086
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 274 1695 6 33
Genomic Location (Zv9):
Chromosome 3 (position 30908100)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30626139
GRCz11 3 30756981
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATCCCAGAATGCCTCAGGAAACACTGCCCTGCACATATGTGCTTTATA[T/G]AACAAGGTATAACCACTGCACCTTACACACAAAAACAAAGCAAATATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33197
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 460 1695 12 33
Genomic Location (Zv9):
Chromosome 3 (position 30900622)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30618661
GRCz11 3 30749503
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTACAGCGCCGTTCCTGGCCGAGTTTTTGTTGCCACTCGCTCACACT[C/A]GGCCCAGGGTGACCGCGAAATCAGCTTCAACAAGGGAGACAAAGTCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40085
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 522 1695 14 33
Genomic Location (Zv9):
Chromosome 3 (position 30897158)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30615197
GRCz11 3 30746039
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGGATGCGGTTGTGTTTGCATCTTTCAGAGAGCCGCAGTGAGAGAGCC[A/T]AGAGACTCTTCCGGCATTATACTGTTGGATCCTACGACAGCTTCGATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45142
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 768 1695 20 33
Genomic Location (Zv9):
Chromosome 3 (position 30857323)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30575362
GRCz11 3 30706204
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCCCGCACGGTATGCTGCGACAGAAGTCTATCGGTGAGGCTGTCTGTT[T/A]GTCCATCTGTCTGTCTGCCCACCTGTGTGTCTGTTTAACCATACTGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20033
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 846 1695 21 33
Genomic Location (Zv9):
Chromosome 3 (position 30856123)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30574162
GRCz11 3 30705004
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTATGTCTCAGTCTACTTCCTCTGCTGCACATTATCAACTCTACTCA[C/T]AGTCAGTACATGTTACTCACGGACCAAGGGACAGGTCCCCTGGACCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40084
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 1022 1695 25 33
Genomic Location (Zv9):
Chromosome 3 (position 30855262)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30573301
GRCz11 3 30704143
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACTCAGACTTCTCAACAGCAGCTGAGTTCCCAGCCTTCACCACGCCTG[C/T]GACCATCCAAATCTATAGATGAAGGCATGTTCTCAGGTGATACTTTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33196
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 1388 1695 29 33
Genomic Location (Zv9):
Chromosome 3 (position 30853216)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30571255
GRCz11 3 30702097
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATGCACAATGCCAAAGCCGCTAGCACTGCATCCACCTACCCAAAAACA[C/T]AGAGGTACAGAGAAGGCACCCGGGCTGGAGATCTTCGACGCCAGACCAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26080
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Essential Splice Site 1578 1695 33 33
Genomic Location (Zv9):
Chromosome 3 (position 30851751)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30569790
GRCz11 3 30700632
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCCCCCTCCCCCCCTCTATTTGCCCCCTCGGGTGCTCCCCCTCCTCC[A/C]AATTCCTCTCTGGTGGTCTCACGGTCCCTGTCACCCACTCACTTCCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12603
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 1640 1695 33 33
Genomic Location (Zv9):
Chromosome 3 (position 30851563)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30569602
GRCz11 3 30700444
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTGCCTCAAAACCTCTCCCATACTGGACCAAGTATGATGTTGCAGATT[G/A]GCTGGGCTACCTGAACCTGGGTGAACAMAGGGAGCGATTCTTAGACAATG
Associated Phenotype:
Not determined