Busch Lab

ZMP

si:dkey-162f21.5

Ensembl ID:
ENSDARG00000060522
ZFIN ID:
ZDB-GENE-081104-321
Human Orthologues:
AL391868.1, RFK
Human Descriptions:
Riboflavin kinase [Source:UniProtKB/Swiss-Prot;Acc:Q969G6]
riboflavin kinase [Source:HGNC Symbol;Acc:30324]
Mouse Orthologue:
Rfk
Mouse Description:
riboflavin kinase Gene [Source:MGI Symbol;Acc:MGI:1914688]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa27246 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa27246
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085371 Essential Splice Site 28 163 2 4
Genomic Location (Zv9):
Chromosome 8 (position 39659281)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 38538084
GRCz11 8 38571023
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACCCCTAATAGAAAAAAAATACTAATTTAATTTTTCCATTTCTTACTT[A/C]GCAAATTTCCCAGAGTCTGTTGTGGACAGTCTCCCCACTGACATCAGCAC
Long Flanking Sequence:
TTTTTCATGATTAAAAATAAACCAGGGCTAAGAATAAAATACATCAAATAAGTCTTAAGTTTACATAAAAGTAGAAAGCAATCAATTTCTATTTTGACTGTGTATTCTTAATTGTGTATTCTACAAAATAGATTCTGCTGTGACTAATTTAGAGATGTGTTCTTTTTCGTCACAAACATCTCTGCACATTAGCATTTTCAGCTTGTTTAACAGCTGTGTGCTTGTTTGTTGCAATTCTAAAAACTATGTGCTGGTAATAAAAAAAGTATCTTATAACTTTGATGCAGTTTTTCTTATTCATTTACAAATATTGTGATATATCACAATATTATATCACAATATTGTGGAATTTTTTTTTGTAAAATGTCAGTATATCACTGATATTGTTATATATCAATATCAGGGGAAAAATATTGGGATAATCTCGTATTGTAAGTTTACCCGGGATTCCCACCCCTAATAGAAAAAAAATACTAATTTAATTTTTCCATTTCTTACTT[A/C]GCAAATTTCCCAGAGTCTGTTGTGGACAGTCTCCCCACTGACATCAGCACTGGCATCTACTACGGTTGGGCACGTCTTGATAATGGAGATATACACAAGATGGTAATGAGCATTGGCTGGAACCCTTACTACAAAAACACAAAAAAGTCCATGGTATGTACATATAAATCTTTCTAGGGTGCAAACTCGTTTGATGTTTGCATTCCATAAATACTACTTAAAAACCCTCTATTATGCATTATAAAAGGTCATTTTGGTTTTGGGAGTCTTCAACAACAGGCTGATATGCATGCAAGGTCAAAAACACTTTCATTGTCTTATATTATGCATTTATTTTTATCTAGTTATCCCAGTGACTCATAACTTGTTCAGTGATTCATTTGTTCCCAAACTTCTCCTTTGCGTGATACTAATCTGCAGTGATTGGTCCGATGACCCCGTCTGTTGTGATTGGTTGACTGCGTTCAGCGTTAGACGGAGAGAAACGCCCACCACGGTCA
Associated Phenotype:
Not determined