Busch Lab

ZMP

LOC570106

Ensembl ID:
ENSDARG00000060504
Human Orthologue:
PFKL
Human Description:
phosphofructokinase, liver [Source:HGNC Symbol;Acc:8876]
Mouse Orthologue:
Pfkl
Mouse Description:
phosphofructokinase, liver, B-type Gene [Source:MGI Symbol;Acc:MGI:97547]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15186 Nonsense Available for shipment Available now
sa21608 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15186
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085284 Nonsense 52 780 2 22
Genomic Location (Zv9):
Chromosome 9 (position 54291901)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53135067
GRCz11 9 52674574
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGTGACACGAATGGGCATCTATGTRGGCGCCAAGGTCTATCTGGTGTA[C/A]GAGGTATTCAAAAACACYGATGAAAGCCTTTCAAATGCTAAATGTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21608
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085284 Nonsense 96 780 4 22
Genomic Location (Zv9):
Chromosome 9 (position 54281238)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53124404
GRCz11 9 52663911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGAGGAACAGTGATTGGCAGTGCCCGCTGTAAAGCATTCACCATGCGT[G/T]AGGGCCGGTTAGCGGCAGCATTTAACCTGGTGAAGCGTGGCATCTCTAAC
Associated Phenotype:
Not determined