Busch Lab

ZMP

EPB41L2

Ensembl ID:
ENSDARG00000060497
Description:
erythrocyte membrane protein band 4.1-like 2 [Source:HGNC Symbol;Acc:3379]
Human Orthologue:
EPB41L2
Human Description:
erythrocyte membrane protein band 4.1-like 2 [Source:HGNC Symbol;Acc:3379]
Mouse Orthologue:
Epb4.1l2
Mouse Description:
erythrocyte protein band 4.1-like 2 Gene [Source:MGI Symbol;Acc:MGI:103009]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23623 Nonsense Available for shipment Available now
sa14839 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23623
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085281 Nonsense 143 568 5 11
Genomic Location (Zv9):
Chromosome 20 (position 2355447)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2309732
GRCz11 20 2329755
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCAGGCCGAGCTGGGCGACCAGGACCCGGACGAGCACCGCCTCGACTA[C/A]ATCTCAGACTTCCAGTTCGCCCCAAACCAGACCAAGGAGCTGGAGGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14839
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085281 Nonsense 236 568 7 11
Genomic Location (Zv9):
Chromosome 20 (position 2346116)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2300401
GRCz11 20 2320424
KASP Assay ID:
1641-0505.1 (used for ordering genotyping assays)
KASP Sequence:
CGWCWGCGGATAAAYCGMTTCGCYTGGCCCAAAATCCTCAAGATYTCCTA[C/A]AAGCGCAGCAACTTCTACATCAAGATCAGGCCGGGAGAGGTGCGRCACAC
Associated Phenotype:
Not determined