Busch Lab

ZMP

vps8

Ensembl ID:
ENSDARG00000060477
ZFIN ID:
ZDB-GENE-060503-348
Description:
vacuolar protein sorting-associated protein 8 homolog [Source:RefSeq peptide;Acc:NP_001074085]
Human Orthologue:
VPS8
Human Description:
vacuolar protein sorting 8 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29122]
Mouse Orthologue:
Vps8
Mouse Description:
vacuolar protein sorting 8 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2146407]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa19514 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25599
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041419 Essential Splice Site 24 456 1 15
ENSDART00000101779 Essential Splice Site 24 455 1 15
ENSDART00000131092 None None 1263 None 43
ENSDART00000134311 None None 146 None 6
ENSDART00000143639 Essential Splice Site 24 1412 1 45
ENSDART00000146783 None None 235 None 9
Genomic Location (Zv9):
Chromosome 1 (position 29071206)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29279821
GRCz11 1 30083752
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTCTTGTTTCTGCGTCGTCACAGCTCAATTTAATGGAAATAGAGGCGG[T/A]ACGTCTGAGATTGACTAACGTTAACGTTAAGATGATTCAGTGTCTATGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25600
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041419 Nonsense 200 456 8 15
ENSDART00000101779 Nonsense 200 455 8 15
ENSDART00000131092 Nonsense 176 1263 7 43
ENSDART00000134311 None None 146 None 6
ENSDART00000143639 Nonsense 200 1412 8 45
ENSDART00000146783 None None 235 None 9
Genomic Location (Zv9):
Chromosome 1 (position 29076854)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29285469
GRCz11 1 30089400
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTATGGGAAGTCTCTGTTTGTTCTTAATACAGATCACCATGTGGGATT[T/A]GGCCAATGGGAAGCTGCTGCGCACCATTACTGATGCCCATCCACCTGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19514
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041419 None None 456 None 15
ENSDART00000101779 None None 455 None 15
ENSDART00000131092 Essential Splice Site 1040 1263 35 43
ENSDART00000134311 None None 146 None 6
ENSDART00000143639 Essential Splice Site 1064 1412 36 45
ENSDART00000146783 None None 235 None 9
Genomic Location (Zv9):
Chromosome 1 (position 29192525)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29401140
GRCz11 1 30205071
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGAGAGGAAAGGAGATGTACAGGGAGCTTTTCAAGTCCTGCTGCAGG[T/C]TTGAGTTTATCACATCACACATGCCTGCAGACAAAAAGAGAGAAAAAAAC
Associated Phenotype:
Not determined