Busch Lab

ZMP

ENSDARG00000060458

Ensembl ID:
ENSDARG00000060458
Human Orthologue:
HRH3
Human Description:
histamine receptor H3 [Source:HGNC Symbol;Acc:5184]
Mouse Orthologue:
Hrh3
Mouse Description:
histamine receptor H3 Gene [Source:MGI Symbol;Acc:MGI:2139279]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa43742 Nonsense Mutation detected in F1 DNA Not yet available
sa37396 Nonsense Mutation detected in F1 DNA Not yet available
sa44977 Nonsense Mutation detected in F1 DNA Not yet available
sa37397 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29685
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085196 Nonsense 68 398 2 3
Genomic Location (Zv9):
Chromosome 22 (position 1121836)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3037610
GRCz11 22 3055164
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGCTTTCTGCATCCCGCTCTATATGCCCTACATTTTGACGGGCAGATG[G/A]ATGCTGGGTCGTGGACTCTGCAAGCTGTGGCTGGTGATGGACTACTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43742
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085196 Nonsense 294 398 3 3
Genomic Location (Zv9):
Chromosome 22 (position 1144840)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3060614
GRCz11 22 3078029
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTGGGTTCGGACGCGGATTATTCGAGCGCAGGAAGTGACGAATCCCTG[T/A]GCGCCTTGCCGAAGCGGCGGACACGCACGTCTTTCTAGAGATAAGAAGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5688
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085196 Nonsense 348 398 3 3
Genomic Location (Zv9):
Chromosome 22 (position 1145002)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3060776
GRCz11 22 3078191
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGATGATCATAAGGGCAGCCTGCAGTGGTAGCTGTGTGGAGCATCATTG[G/A]TATGAAGTCACATTTTGGCTTCTTTGGCTTAATTCGGCCATCAATCCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37396
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085196 Nonsense 357 398 3 3
Genomic Location (Zv9):
Chromosome 22 (position 1145029)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3060803
GRCz11 22 3078218
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTAGCTGTGTGGAGCATCATTGGTATGAAGTCACATTTTGGCTTCTTTG[G/A]CTTAATTCGGCCATCAATCCCTTCCTGTATCCACTGTGCCACAGCAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44977
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085196 Nonsense 387 398 3 3
Genomic Location (Zv9):
Chromosome 22 (position 1145117)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3060891
GRCz11 22 3078306
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCACAGCAGCTTTCGGCGAGCGTTCGCTAAGATCCTGTGCCCAAAACGG[C/T]AGTCTGTTCAACCGCACGAGGAAAGCCCTTCATGCCCATGACAGTCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37397
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085196 Nonsense 393 398 3 3
Genomic Location (Zv9):
Chromosome 22 (position 1145135)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3060909
GRCz11 22 3078324
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCGTTCGCTAAGATCCTGTGCCCAAAACGGCAGTCTGTTCAACCGCAC[G/T]AGGAAAGCCCTTCATGCCCATGACAGTCTGACAGGGATTTTAACACTGGA
Associated Phenotype:
Not determined