Busch Lab

ZMP

sdk2b

Ensembl ID:
ENSDARG00000060452
ZFIN ID:
ZDB-GENE-030131-8203
Description:
Novel protein similar to vertebrate sidekick homolog family (Chicken) [Source:UniProtKB/TrEMBL;Acc:B
Human Orthologue:
SDK2
Human Description:
sidekick homolog 2 (chicken) [Source:HGNC Symbol;Acc:19308]
Mouse Orthologue:
Sdk2
Mouse Description:
sidekick homolog 2 (chicken) Gene [Source:MGI Symbol;Acc:MGI:2443847]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa31893 Nonsense Available for shipment Available now
sa38902 Nonsense Mutation detected in F1 DNA Not yet available
sa12667 Nonsense Available for shipment Available now
sa24919 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1344 Essential Splice Site Available for shipment Available now
sa35360 Nonsense Mutation detected in F1 DNA Not yet available
sa35359 Nonsense Mutation detected in F1 DNA Not yet available
sa2625 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa31893
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Nonsense 367 2254 9 46
ENSDART00000140353 Nonsense 321 2035 8 44
Genomic Location (Zv9):
Chromosome 12 (position 39108379)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37395793
GRCz11 12 37570535
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCTCTTTTCCTTTTGATTTCAGGTGTTCCTCAGCCTGATATTGTGTG[G/A]TATAAAGATGCAGTTCCCATAAGCCCTGTGAAGACGCCGCGCTACAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38902
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Nonsense 795 2254 17 46
ENSDART00000140353 Nonsense 749 2035 16 44
Genomic Location (Zv9):
Chromosome 12 (position 39082800)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37370214
GRCz11 12 37544956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGAGGATCTCATCATCTGGACTAATTATGAAATCGAAGTGGCGGCTTA[T/G]AATGGAGCTGGACTGGGGGTTTACTGTCATAAAGTTACAGAGTGGACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12667
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Nonsense 989 2254 21 46
ENSDART00000140353 Nonsense 943 2035 20 44
Genomic Location (Zv9):
Chromosome 12 (position 39073661)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37361075
GRCz11 12 37535817
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACGTGACTCTGGAGTACCGAGYGACCGGACTGACGGCTCTCACCACATA[C/A]ACCATTGAGGTGGCAGCCATGACCTCTAAAGGCCAGGGTCAGCTGTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24919
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Essential Splice Site 1261 2254 26 46
ENSDART00000140353 Essential Splice Site 1214 2035 25 44
Genomic Location (Zv9):
Chromosome 12 (position 39060374)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37347788
GRCz11 12 37522530
KASP Assay ID:
554-7540.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTTGAAGTTCCGGAACCTGACCGGAATGGACTCATCCTAGGATATAAG[G/A]TCAGTGAGGAATTAAAATTAAACTAAAGGGTGTGATACAACAGACTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1344
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Essential Splice Site 1422 2254 29 46
ENSDART00000140353 Essential Splice Site 1375 2035 28 44
Genomic Location (Zv9):
Chromosome 12 (position 39058230)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37345644
GRCz11 12 37520386
KASP Assay ID:
554-1258.1 (used for ordering genotyping assays)
KASP Sequence:
GGGATGGGGAGAGGCGGCGGAAGCCTTAGTCGTCACTACCGAGAAGAGAG[G/A]TAATCTACATTATTATCACACATCAACAATGGGGAAAAACAAACTCAAAC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa35360
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Nonsense 1469 2254 30 46
ENSDART00000140353 Nonsense 1422 2035 29 44
Genomic Location (Zv9):
Chromosome 12 (position 39052970)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37340384
GRCz11 12 37515126
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGTTTATCGCCAATCCGTTATTACACGGTTCAGGTCCGCGAGCTGCCC[G/T]AGAAGAACTGGACAGTGCATTCTGCCTCTGTCAGCCACGAGTCCAGCTCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4478
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Essential Splice Site 1593 2254 33 46
ENSDART00000140353 Missense 1543 2035 32 44
ENSDART00000085121 Essential Splice Site 1593 2254 33 46
ENSDART00000140353 Missense 1543 2035 32 44
Genomic Location (Zv9):
Chromosome 12 (position 39046757)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37334171
GRCz11 12 37508913
KASP Assay ID:
2260-5697.1 (used for ordering genotyping assays)
KASP Sequence:
TAGTGTTCATACCATCAGCAGTGCTTCAGCCAGCTGGGCAGAACTCACMT[G/T]TGAGTATAAAATATATCTACTAAGAGTAGGTGATGACAATTCCTCTGATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19045
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Essential Splice Site 1593 2254 33 46
ENSDART00000140353 Missense 1543 2035 32 44
ENSDART00000085121 Essential Splice Site 1593 2254 33 46
ENSDART00000140353 Missense 1543 2035 32 44
Genomic Location (Zv9):
Chromosome 12 (position 39046757)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37334171
GRCz11 12 37508913
KASP Assay ID:
2260-5697.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTGTTCATACCATCAGCAGTGCTTCAGCCAGCTGGGCAGAACTCACAT[G/T]TGAGTATAAAATATATCTACTAAGAGTAGGTGATGACAATTCCTCTGATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28001
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Nonsense 1721 2254 37 46
ENSDART00000140353 Nonsense 1671 2035 36 44
Genomic Location (Zv9):
Chromosome 12 (position 39041737)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37329151
GRCz11 12 37503893
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCCAGAAGGAGGGGTAAAGTTGAAGAACTTAACAGGCTACACCACCTA[C/A]ATGATCAGCGTCGCTGCTTTCAACGCCGCCGGTGATGGGCCACGCAGCCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19044
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Essential Splice Site 1794 2254 38 46
ENSDART00000140353 Essential Splice Site 1744 2035 37 44
Genomic Location (Zv9):
Chromosome 12 (position 39036454)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37323868
GRCz11 12 37498610
KASP Assay ID:
2260-5694.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCATCGAGGGCTACAGACTCATCTATGAGCCCTGCATGCCTGTGGATGG[T/G]CAGTGAATTTCTTGTTTGGTGGATTTAGCATCCTGGTTCAACAGTATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35359
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Nonsense 1892 2254 40 46
ENSDART00000140353 Nonsense 1826 2035 39 44
Genomic Location (Zv9):
Chromosome 12 (position 39034756)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37322170
GRCz11 12 37496912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGATATGGCTCCGCCCTCACCATCCACTGGGCCAATGGGGACCCTGGA[C/T]GAGCACCAATCACACGCTATGTTATTGAAGCCAGACCCTCAGGTGAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2625
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 None 2118 2254 46 46
ENSDART00000140353 Nonsense 2034 2035 44 44
Genomic Location (Zv9):
Chromosome 12 (position 39001852)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37289266
GRCz11 12 37464008
KASP Assay ID:
554-2444.1 (used for ordering genotyping assays)
KASP Sequence:
WGTTCGCTCTCCATTTCTCACCCGTTCCCTTTCTTTCCACTGTAGGGCAG[C/T]GACAGTGAATATGAGGTGGACCCCAACCGYCAGAAGACCCATTCCTTTGT
Associated Phenotype:
Not determined