Busch Lab

ZMP

si:ch211-1o14.5

Ensembl ID:
ENSDARG00000060415
ZFIN ID:
ZDB-GENE-060531-28
Description:
Novel protein similar to vertebrate rho/rac guanine nucleotide exchange factor (GEF) 18 (ARHGEF18) [
Human Orthologue:
RP11-428C6.1
Human Description:
Rho-guanine nucleotide exchange factor [Source:UniProtKB/Swiss-Prot;Acc:Q8N1W1]
Mouse Orthologue:
Rgnef
Mouse Description:
Rho-guanine nucleotide exchange factor Gene [Source:MGI Symbol;Acc:MGI:1346016]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa26519 Nonsense Mutation detected in F1 DNA Not yet available
sa20469 Nonsense Available for shipment Available now
sa40486 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa26517 Nonsense Mutation detected in F1 DNA Not yet available
sa16048 Nonsense Available for shipment Available now
sa40485 Essential Splice Site, Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5307
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085086 None None 944 None 24
ENSDART00000133170 Essential Splice Site 231 1326 4 25
Genomic Location (Zv9):
Chromosome 5 (position 36503692)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34285641
GRCz11 5 34885794
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACGCGCTCTCACTCTGCCTCCTCTGCCTGTAACCCCGCCCCTGCAAAGG[T/C]ACGCCTTTATACTAAAGCTKTGCAGTTAATCATTTAATTGMATTTGAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26519
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085086 Nonsense 23 944 1 24
ENSDART00000133170 Nonsense 318 1326 7 25
Genomic Location (Zv9):
Chromosome 5 (position 36493654)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34275603
GRCz11 5 34875756
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAAGTACAAAGTCAGCCGCACATTCAGCTTCATAAAGAGCCGAATGTA[T/G]AGCACTCGCAACAAGAACAAGGTAAATATTGCATACAGTACATGAAATAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26518
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085086 None None 944 None 24
ENSDART00000133170 Essential Splice Site 409 1326 10 25
Genomic Location (Zv9):
Chromosome 5 (position 36489752)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34271701
GRCz11 5 34871854
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAATATTCAGTGATGACAGTAAAAAGCAAGACAGCCTCTCTTCCTCAAA[G/T]TGAGTATTACATGCTGTGTTGTAAGGTAATGTAAGGTAATCAATCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20469
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085086 Nonsense 394 944 13 24
ENSDART00000133170 Nonsense 666 1326 15 25
Genomic Location (Zv9):
Chromosome 5 (position 36483489)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34265438
GRCz11 5 34865591
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTACTTCAAAGAGCTTCAGCAGCAGAACAAGAGATTTCAGCTCTTCATC[A/T]AAGTGAGAGACCCATCAACCAATACTTTATAAGTCGAATATTAATGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40486
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085086 Essential Splice Site 518 944 15 24
ENSDART00000133170 Essential Splice Site 790 1326 17 25
Genomic Location (Zv9):
Chromosome 5 (position 36482921)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34264870
GRCz11 5 34865023
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCACCAGGGCCCGCTGCTCTGGAAGACAGCCACTGGAAGACTGAAAGG[T/G]CAGACTGACAACACTTAATACAATATTTAACATAAAAGATATTGTGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26517
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085086 Nonsense 552 944 17 24
ENSDART00000133170 Nonsense 824 1326 19 25
Genomic Location (Zv9):
Chromosome 5 (position 36480518)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34262467
GRCz11 5 34862620
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTCGTCTTGCTGTATTTGTCAGGACCAGAAGCCTCCAGTGATCTCTT[T/A]GCAGAAACTAATTGTGCGTGAGGTGGCCAATGAAGAGAGAGGCATGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16048
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085086 Nonsense 672 944 20 24
ENSDART00000133170 Nonsense 947 1326 21 25
Genomic Location (Zv9):
Chromosome 5 (position 36477124)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34259073
GRCz11 5 34859226
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGTGATGGCAGGCCAGCGAGAGGCAGGACCAGAGCCCAGGCTGCTGGTA[C/T]GACCCAGCACTGAAGACRTTCCCCAGGCKGGAGTACTACTCAGCGCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40485
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085086 Essential Splice Site 782 944 23 24
ENSDART00000133170 Splice Site None 1326 None 25
Genomic Location (Zv9):
Chromosome 5 (position 36469853)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34251802
GRCz11 5 34851955
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTTTTGGTGTAATGTTTCATAACTTTCTGTCACTCAGTGTTTTTGTTT[G/A]TTTGCAGGTGAGTCAGAGTGTGCAGAGCTTGACTCAGCTGCTGTACAGTC
Associated Phenotype:
Not determined