Busch Lab

ZMP

ENSDARG00000060413

Ensembl ID:
ENSDARG00000060413
Human Orthologue:
FGL2
Human Description:
fibrinogen-like 2 [Source:HGNC Symbol;Acc:3696]
Mouse Orthologue:
Fgl2
Mouse Description:
fibrinogen-like protein 2 Gene [Source:MGI Symbol;Acc:MGI:103266]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa45262 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33924 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45262
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085090 Essential Splice Site 158 392 3 6
Genomic Location (Zv9):
Chromosome 6 (position 40710637)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40782237
GRCz11 6 40779773
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTATCACACATTCTAAACCTAATAGCCTCAAACCAAGGACTCCTACAGG[T/C]GAGCCACACACACACAGAAAGATAGCCAGGCAGATACACAGAACAAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33924
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085090 Nonsense 386 392 6 6
Genomic Location (Zv9):
Chromosome 6 (position 40713998)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40785598
GRCz11 6 40783134
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACTGAGTATCGCACTGGGGAAAGATATTCATTTAAGAGTGTTGAAATG[A/T]AAACGAGACCCAGGCGAAGCTAAGAAAAAAGTCTTTTTTAATGAGAATTT
Associated Phenotype:
Not determined