Busch Lab

ZMP

THBS2 (1 of 3)

Ensembl ID:
ENSDARG00000060410
Description:
thrombospondin 2 [Source:HGNC Symbol;Acc:11786]
Human Orthologue:
THBS2
Human Description:
thrombospondin 2 [Source:HGNC Symbol;Acc:11786]
Mouse Orthologue:
Thbs2
Mouse Description:
thrombospondin 2 Gene [Source:MGI Symbol;Acc:MGI:98738]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35548 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28162
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085037 Nonsense 780 1173 14 20
Genomic Location (Zv9):
Chromosome 13 (position 35887898)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35540474
GRCz11 13 35666306
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGACTATGATAAAGATCTTGTCGGTGACCGCTGTGATAACTGCCCATAC[G/T]AGCACAATCCTGCTCAGATTGACACAGACGGTAATGGCGAAGGGGACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35548
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085037 Nonsense 1091 1173 18 20
Genomic Location (Zv9):
Chromosome 13 (position 35893810)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35546386
GRCz11 13 35672218
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACAGGAGAGCACCTTCGCAATGCCCTGTGGCACACTGGGGACACACCT[G/T]GACAGGTCAGACTGATCAGATATTATTTACAGTTGAAGTGGGACGAATTA
Associated Phenotype:
Not determined