Busch Lab

ZMP

si:dkey-127k13.1

Ensembl ID:
ENSDARG00000060395
ZFIN ID:
ZDB-GENE-070912-368
Description:
LOC100007612 protein [Source:UniProtKB/TrEMBL;Acc:A8WFX2]
Human Orthologues:
MUM1, MUM1L1
Human Descriptions:
melanoma associated antigen (mutated) 1 [Source:HGNC Symbol;Acc:29641]
melanoma associated antigen (mutated) 1-like 1 [Source:HGNC Symbol;Acc:26583]
Mouse Orthologues:
DXBay18, Gm14685, Gm5640, Gm5936, Mum1, Mum1l1
Mouse Descriptions:
DNA segment, Chr X, Baylor 18 Gene [Source:MGI Symbol;Acc:MGI:99870]
melanoma associated antigen (mutated) 1 Gene [Source:MGI Symbol;Acc:MGI:1915364]
melanoma associated antigen (mutated) 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2445062]
predicted gene 14685 Gene [Source:MGI Symbol;Acc:MGI:3710618]
predicted gene 5640 Gene [Source:MGI Symbol;Acc:MGI:3645126]
predicted gene 5936 Gene [Source:MGI Symbol;Acc:MGI:3645575]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa44540 Nonsense Mutation detected in F1 DNA Not yet available
sa38342 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39885 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5155
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085046 Nonsense 167 1140 1 17
ENSDART00000146820 None None 558 None 13

The following transcripts of ENSDARG00000060395 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37182058)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37478768
GRCz11 2 37461225
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACACTTAAGCTCTCAAAAACCTAAAAGGACACATCATCAAAACTCTAAA[C/T]GAACTCAAAATCATCAGACTCCTTCTGATGTTTCGACAGGTGTTTACACR
Long Flanking Sequence:
CAATGGTTGCAGGAATGAGTTCTTCAGATGAGTCTTTAAAGCGCCAAAGGAATCCTCACAGGACCTGTCGCACAGACTCTACACAAGTCAACGAACCAGTTTCAGGTGGCACCGAATCAATTACTCATAATAAAAGAACCACAGCACCTCAAGATCTGATTCTTGTGAAGTCATGTGGAAGGAGAGCAACTGAGAACAAACCACAAGCAGCAAACCAAAATGCTCCTCCTTGTTTACGGAAATCAAGACGCCAGGTTACAAATATAAATGGATGTGTATCTAAAAAGTCACATCAACCTGAGCAGGTCTTGCCTCGAAAAATCGCCACCCCCAAATATCAAATAAAGACAGCTTACAAGGGAAGAAGAAAAAAGAATGTTGAAGCAAGTGAGAAAAAGGTAGCTGCTAGCAAAGCTAAATTGGATGTACTAGACAATTTGTGCTCAGAACAACACTTAAGCTCTCAAAAACCTAAAAGGACACATCATCAAAACTCTAAA[C/T]GAACTCAAAATCATCAGACTCCTTCTGATGTTTCGACAGGTGTTTACACGTGTACTACATTATCTCCTTGTCGTTGCAAGGAGGATTCATGCTGCCACACTAACAGACCACAAGCCCCATTACAGGACAGACTCCAGTTTACGTCTCTCCTCAGCTCCACCTCAAACTCTGACCTCAAGTCCCTGTCGCCACAAACAGGTCAGAATAGTTGTGTACCACATAGTGAGCCGGATGTCTTAAAGTCCAGCCTAGAAAAGGTTTGAGTGAGCATCATTACATTTTTAATCAGTAACTTTTGTTTGAATGCCTGGAATAATTTTTCCTTGTATTTTTTAGAGACCTCCGACAGATGCCTCACCATCACCTCAGAGAGCCAGAGGAAGGCCGAAAGGCAACAATAATAAAGTACAAGAGGATCCAAGTTCTTTTCTTCCATTGAAACACAGCAGGGAGTCCACAGAGTGTCCTGTTGAATACCCAAAACGTTTTCTCCACAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44540
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085046 Nonsense 681 1140 6 17
ENSDART00000146820 Nonsense 99 558 2 13

The following transcripts of ENSDARG00000060395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37178980)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37475690
GRCz11 2 37458147
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCCTCTCCTAAGCTCCACCCCAAGCTCTCATCTCCAACCCCTGACAT[C/A]AAAAAGAGAAGACAATAATCCAGCACCAAATGCCACAAAGTCTAGACTAG
Long Flanking Sequence:
ATCTCTCCACCAGTGAAATGCAGCAGGAAATTCACAGAGTGTCTTGCTGCATCCCACACCCCTAAACAGAAAAGGCTTCAGTCCAGTCCTCTCCTTAGCTCCACCCCAAGCTCTCATCACCTACCCCTAATACCATTAAGAGCAGACAATAATCCAGCACCAAATGCCACAAAGTCTAGACTACAAAAGGTTTGTTTGATCATTATTGTAACAACATTGATTGCTAACTTTTGTTTGAGTTTCTTGGGACAATTATTGCTCGTGGTGTTTTTAGAGACCTCCTGCAGACGCCTCACCATCAACACCTCAGAGACCCAGAGGAAGACCAAAAGGCAGCATGAATAAGAAAGTACAGGAGGGGGCAAGTGTTTCTCCACCAGTGAAACGCAGCAGGAAATTCACAGAGTGTCTTGCTGAATCCCACACTCCAAAACAGAAAAGGCTTAAGTCCAGTCCTCTCCTAAGCTCCACCCCAAGCTCTCATCTCCAACCCCTGACAT[C/A]AAAAAGAGAAGACAATAATCCAGCACCAAATGCCACAAAGTCTAGACTAGAAAAGGTTTGTTTGATCATTATTGTAACAATATTGATTGCTAACTTTTGTTTGAGTTTCTTGGGACAATCATTGCTCGTGGTGTTTTTTAGAGACCTCCTGCAGACACCTCACCATCAACACCTCAGAGAACCAGAGGAAGATCAAAAGGCAGCACGAATAAGAAAGTACAGGAGGGGGCAAGTGTTTCTCCACCAGTGAAACGCAGCAGGAAGAGCACAGAGTTTCCTGCTGAAATGCAAACTCTGAGTAGTCCTTGCTCTGAAAATCAGGAACCAGAGCCTAATGAGTCGGGTATATTTGTATATTTCATGTATATCAAGTGAAATATCAGGCATAAAACAGACGACTGAGGGTGCTTTCACACCTGTGAATCGATTCAGTTGTTCCGAAACAGAGATTACAAATGTTACATTGTTGCTCTTTGCTCTTGGAGCGGTTTGCTTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38342
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085046 Essential Splice Site 767 1140 7 17
ENSDART00000146820 Essential Splice Site 185 558 3 13

The following transcripts of ENSDARG00000060395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37178635)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37475345
GRCz11 2 37457802
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAGTAGTCCTTGCTCTGAAAATCAGGAACCAGAGCCTAATGAGTCGGG[T/A]ATATTTGTATATTTCATGTATATCAAGTGAAATATCAGGCATAAAACAGA
Long Flanking Sequence:
GAAAGTACAGGAGGGGGCAAGTGTTTCTCCACCAGTGAAACGCAGCAGGAAATTCACAGAGTGTCTTGCTGAATCCCACACTCCAAAACAGAAAAGGCTTAAGTCCAGTCCTCTCCTAAGCTCCACCCCAAGCTCTCATCTCCAACCCCTGACATCAAAAAGAGAAGACAATAATCCAGCACCAAATGCCACAAAGTCTAGACTAGAAAAGGTTTGTTTGATCATTATTGTAACAATATTGATTGCTAACTTTTGTTTGAGTTTCTTGGGACAATCATTGCTCGTGGTGTTTTTTAGAGACCTCCTGCAGACACCTCACCATCAACACCTCAGAGAACCAGAGGAAGATCAAAAGGCAGCACGAATAAGAAAGTACAGGAGGGGGCAAGTGTTTCTCCACCAGTGAAACGCAGCAGGAAGAGCACAGAGTTTCCTGCTGAAATGCAAACTCTGAGTAGTCCTTGCTCTGAAAATCAGGAACCAGAGCCTAATGAGTCGGG[T/A]ATATTTGTATATTTCATGTATATCAAGTGAAATATCAGGCATAAAACAGACGACTGAGGGTGCTTTCACACCTGTGAATCGATTCAGTTGTTCCGAAACAGAGATTACAAATGTTACATTGTTGCTCTTTGCTCTTGGAGCGGTTTGCTTTCACACTGCAAAGTTTCTAATCGGACCAAAAGAGCTAAAACAAGTCACGTGTGAGTAAACTCTCCTCACATTGGTCAGAGTGTCAGGGTTTATTTTGCAGCGTCCCACTTAGCTGTCAGGAGAGGTGGTGGTTTGGTGGTGATTGACAGGGTGCGCGTGCGCGACGTGTCTGAGGAGAGACCAACACTGGGGAGGGGTGAGAAGGGTGACGACGATGCCTATTTGAGGACCGGGAGGGAGACGCGAGATTACCGGGAGATCATCACTCATTTGCGGGCATCCGGAGACTCGCGAAACTTCCTGCCCTGCTCATAATTCTCTCTTCATATAGCCGTAAGCCTATTACATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39885
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085046 Nonsense 813 1140 8 17
ENSDART00000146820 Nonsense 231 558 4 13

The following transcripts of ENSDARG00000060395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37176567)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37473277
GRCz11 2 37455734
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAGATGATCAGGATGATGATGACGATGACGAGGAGCTGCCCAGCTTTT[T/A]GGGGCAGGACAGTAAAAGTGAGTGAGCAATAAAAGTGTAGATAAAAATAG
Long Flanking Sequence:
TTCAAATGTTAAGGTCTTTACTTGTTGGGCAGTAATAATTTTTTTACAATATTTAGTGTAATTGTATATATTAATTTTATTTAGTACAGGTCAGAATAAATGTTTAATTAAAATTTTTACGTAAATATGTCTATTGCACAGAATGATGATCTTCATATTTCATATTCACTAAGCTACTTAAAAACTTAAAATAGACTTGCTTACATTAAATGAGCTTTTAATGCATGTAGATACATTGTATTTAATGTCAACACCTAAATTGGACCTCTTGTCTTTGACACAGATAAGCTTAGTAAGTCAGTTTGTTATATGTTTTCTGTGTTTTTAATAATGAGTCGCTGTAATCCAGTATGTGCCCACAGATCAAACCATGTCCTCTGACCTGTCCATTGAGCTGAGCCTGCATGAGGATCCTCATCTTCTTAACCACTCACTCTTCATGCAAGAGGAGAAAGATGATCAGGATGATGATGACGATGACGAGGAGCTGCCCAGCTTTT[T/A]GGGGCAGGACAGTAAAAGTGAGTGAGCAATAAAAGTGTAGATAAAAATAGCATTGGCCAGTGCTTTAATTTACTTGATTTTTTAGAGCCTTTGTCGATCTCAGAGGGACTTTGTGTGTGGTGCAAAATGTGGAAATACCCTTACTGGCCTGCGGTGGTAAGTAAAACCAATTTTGTGCAGTTTGCTTTTTTTGTTTTTTTTGTTTAGACTGTTGGTGATGTTGGTGATAAAGTGCTCATCTGTATGACAGGTTAAAAGTGTAAATCGCAAGAACAAAAAAGCCAGCATTATATTTATCGATTGTGACCTCAGTGACCAAAAAAGAGCTAAGAAAGGGTAAGAATTCATTAGAATTCATTTATATAGTCTGTTGTACACCACATTTATAGGTCTTAACATCATCTTCTTTTTGTTATCTCTAGGTTTACTGTGTCTCTGAGAAACTTAAAACCGTTTGATTGTGAGGACTATGAAAAATTGGTGGTAAAGTGTTTAAATCT
Associated Phenotype:
Not determined