Busch Lab

ZMP

si:dkey-164k14.1

Ensembl ID:
ENSDARG00000060372
ZFIN ID:
ZDB-GENE-090311-6
Description:
Plexin A2 [Source:UniProtKB/TrEMBL;Acc:B6E521]
Human Orthologues:
PLXNA2, PLXNC1, PLXND1
Human Descriptions:
plexin A2 [Source:HGNC Symbol;Acc:9100]
plexin C1 [Source:HGNC Symbol;Acc:9106]
plexin D1 [Source:HGNC Symbol;Acc:9107]
Mouse Orthologues:
Plxna2, Plxnc1, Plxnd1
Mouse Descriptions:
plexin A2 Gene [Source:MGI Symbol;Acc:MGI:107684]
plexin C1 Gene [Source:MGI Symbol;Acc:MGI:1890127]
plexin D1 Gene [Source:MGI Symbol;Acc:MGI:2154244]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37759 Nonsense Mutation detected in F1 DNA Not yet available
sa12731 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5061
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084985 None None 553 None 11
ENSDART00000147998 Nonsense 581 1850 6 31
Genomic Location (Zv9):
Chromosome 23 (position 32936581)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32796379
GRCz11 23 32722910
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTCTGCATTTCTCCRGCTGCTAAAGATGTTCCCATCATCCCCGCTGAT[C/T]AAGGTATTTATTTAAACCTGAACTCCATATTGCGGTACTATTTTATCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37759
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084985 Nonsense 293 553 5 11
ENSDART00000147998 Nonsense 1353 1850 21 31
Genomic Location (Zv9):
Chromosome 23 (position 32849942)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32709740
GRCz11 23 32636271
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGTGATCGCGGTAACGTGGCGTCGCTCATCATGACGGCTCTACAGGGT[C/T]GACTGGAATACGCCACGGACGTCCTCAAACACCTGCTGTCCGACCTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12731
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084985 Nonsense 423 553 8 11
ENSDART00000147998 Nonsense 1483 1850 24 31
Genomic Location (Zv9):
Chromosome 23 (position 32835411)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32695209
GRCz11 23 32621740
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAACAGCCCRGAGATCCCGGTCAAGGTTTTGAACTGTGACACCATCACG[C/T]AAGTCAAGGAAAAGATTCTGRATGCTGTGTATAAAAACWTGCCGTATTCW
Associated Phenotype:
Not determined