Busch Lab

ZMP

syn1

Ensembl ID:
ENSDARG00000060368
ZFIN ID:
ZDB-GENE-081105-93
Description:
synapsin-1 [Source:RefSeq peptide;Acc:NP_001119909]
Human Orthologue:
SYN1
Human Description:
synapsin I [Source:HGNC Symbol;Acc:11494]
Mouse Orthologue:
Syn1
Mouse Description:
synapsin I Gene [Source:MGI Symbol;Acc:MGI:98460]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa21334 Nonsense Available for shipment Available now
sa7143 Nonsense Mutation detected in F1 DNA Not yet available
sa14827 Nonsense Mutation detected in F1 DNA Not yet available
sa34436 Nonsense Mutation detected in F1 DNA Not yet available
sa12369 Nonsense Available for shipment Available now
sa21335 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21334
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084969 Nonsense 212 670 5 13
ENSDART00000136578 Nonsense 212 670 6 14
Genomic Location (Zv9):
Chromosome 8 (position 31976751)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31119477
GRCz11 8 31128709
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATATATGTCTCGATGTGATTGTTTGTTCTTTCAGTTCTCTCAGTTGTCC[A/T]GATTGTACAAGCAGTTGGGTCCAGAGGAGTTCCCACTGATCGACCAGGTT
Long Flanking Sequence:
TTGCAATAAAAAAAGATATATGTGTGTGGCACTAAAACTCTTTTAGGGCACATTGTGATATAAATGAGATATTTATAATTTTATTCTAAGTACATTATAATATTATTAATACAATTCAAGCATTTTTTTCTGTATGTCTCAAATATTAAATTAGGAAGTTATCATGGCAACTTTAATGTAATACAGTTCGAAATATTTAGGCCCACCACCCCTCAAACAAGTTTGGGCACCCCTGCTATAAAGCAACACATACACACACTTATACTTGTTAAAGCAACTTTTTCTGCAGCTTAGATCAATAATGGAATAATACTGTATAAAAGCTTTTAGGAAAATTTGATACCATCACAAGCCTGGAATTATTTCTTAAACATGAATTCAACAGGTTGACAACATTCTCTGATGCATCTCCAGTTATAGTTGCACCTATATTATTCCTTATTGCTCTATAATATATGTCTCGATGTGATTGTTTGTTCTTTCAGTTCTCTCAGTTGTCC[A/T]GATTGTACAAGCAGTTGGGTCCAGAGGAGTTCCCACTGATCGACCAGGTTTACTACCCCAACCACAAGGAGATGGTGAGTGTTAACCATCTGTCCCTCTCCTCGCTAGTAAACCCTGAGCTATAGGACACTAGACGGTCCCTCTGGACCCAATACAAAGCCTTCATCCGTGGAAGGGACAGCGGTGCCTGGACTTCGTACACAGTAAAATCTAAAAGGTTCATGCATATACAGTGCCCCAGTGAAGTGCTGCTCCACTCAACTTAGCACAGTCCTGTCTAGACCGGAAATTTTATAACCCCCAGACTGGTATAATTGCTTGGTGCATCATAGTCCTTATAGACACAGTTCAGGTTTTATTAGGAGAGGAAGCCTTACTGCAGTGCCACCACCTCCTCCTATTTCTCCACTGCAGGCATCTTCACACATAAATGATCCCAGACACAGTCTCCGGCAGAATGTTTTCCTCTCTCACTGGCCTTTTTTTTAAGATAAAGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7143
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084969 Nonsense 289 670 7 13
ENSDART00000136578 Nonsense 289 670 8 14
ENSDART00000084969 Nonsense 289 670 7 13
ENSDART00000136578 Nonsense 289 670 8 14
Genomic Location (Zv9):
Chromosome 8 (position 31979404)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31122130
GRCz11 8 31131362
KASP Assay ID:
554-5053.1 (used for ordering genotyping assays)
KASP Sequence:
TTGTGGCTTTGACAAAGACGTATGCCACATCTGAGCCTTTTATTGATGCC[A/T]AGTATGACATCCGAATCCAGAAAATTGGGGAAAATTACAAGGCCTACATG
Long Flanking Sequence:
TATCAAAAATGCTTCTGCAATAATGTCATGCCAATATAGCAACTTGAGAGAGAGCGAGAGAGAGGTAATAGGTGCTGTGGGTAATAAGTGTTTCAATCCGGCTTTACCACCGCAAGTATATTTCAAACCTGTGGGAAACACTGTGTGTCTCTAAATACTTTTAAAATAAATTGCTCTCTTGTCATTAGATTACTACACCTGGCTTTCCTGTGGTAGTGAAGATGGGTCATGCTCATTCTGGCATGGGAAAGGTATGAATGAAATAATTTCTTTAATGTTTATATTAACTGCTGTTTAGATATATATGACCAGTTACATTATTGATTTCATTAATTACATTTGCACATAAATCAAAGCACAAACTATCTATATTACCATATGACTAGTTCAGTCTTTTTCCTGTACAGGTCAAAGTAGACAATCAGTATGATTTCCAAGACATTGCTAGTGTTGTGGCTTTGACAAAGACGTATGCCACATCTGAGCCTTTTATTGATGCC[A/T]AGTATGACATCCGAATCCAGAAAATTGGGGAAAATTACAAGGCCTACATGTAAGAGATTTTAGCCACTATATTATTCTGGTTTCAAACATCATCTTTTGCACTTGCATTATAATTGGAACGGATTGTGAGACACTGTGTCATTCCTGCTGTTGTGTTATTGGACAGGAGGACATCCATATCTGGCAACTGGAAGACCAACACAGGATCAGCCATGCTGGAGCAGGTGGCCATGTCTGACAGGTACATACATCTTATAAAAATCTTATTCTGCCATTATGCAAAACTTCTGTAATATAACATTAGATAGGCCTTTTAGACATTTGGTTGTCTAAAAAAACATATTTAGTGTAATTTAACATTAGTAACACATACTATATGATCATTTCTCTTTTTTTTTGACATGCTTCCTCTCATGACAGCTAACTGCAGGTTAATTCTATAGCAGCATCACATTATCATTCAAAATAAAAAATGAAGTTAAAAAAATGACATGCACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14827
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084969 Nonsense 289 670 7 13
ENSDART00000136578 Nonsense 289 670 8 14
ENSDART00000084969 Nonsense 289 670 7 13
ENSDART00000136578 Nonsense 289 670 8 14
Genomic Location (Zv9):
Chromosome 8 (position 31979404)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31122130
GRCz11 8 31131362
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTGGCTTTGACAAAGACGTATGCCACATCTGAGCCTTTTATTGATGCC[A/G]AGTATGACATCCKAATCCAGAAAATTGGGGAMAATTACAAGGCCTACATG
Long Flanking Sequence:
TATCAAAAATGCTTCTGCAATAATGTCATGCCAATATAGCAACTTGAGAGAGAGCGAGAGAGAGGTAATAGGTGCTGTGGGTAATAAGTGTTTCAATCCGGCTTTACCACCGCAAGTATATTTCAAACCTGTGGGAAACACTGTGTGTCTCTAAATACTTTTAAAATAAATTGCTCTCTTGTCATTAGATTACTACACCTGGCTTTCCTGTGGTAGTGAAGATGGGTCATGCTCATTCTGGCATGGGAAAGGTATGAATGAAATAATTTCTTTAATGTTTATATTAACTGCTGTTTAGATATATATGACCAGTTACATTATTGATTTCATTAATTACATTTGCACATAAATCAAAGCACAAACTATCTATATTACCATATGACTAGTTCAGTCTTTTTCCTGTACAGGTCAAAGTAGACAATCAGTATGATTTCCAAGACATTGCTAGTGTTGTGGCTTTGACAAAGACGTATGCCACATCTGAGCCTTTTATTGATGCC[A/G]AGTATGACATCCGAATCCAGAAAATTGGGGAAAATTACAAGGCCTACATGTAAGAGATTTTAGCCACTATATTATTCTGGTTTCAAACATCATCTTTTGCACTTGCATTATAATTGGAACGGATTGTGAGACACTGTGTCATTCCTGCTGTTGTGTTATTGGACAGGAGGACATCCATATCTGGCAACTGGAAGACCAACACAGGATCAGCCATGCTGGAGCAGGTGGCCATGTCTGACAGGTACATACATCTTATAAAAATCTTATTCTGCCATTATGCAAAACTTCTGTAATATAACATTAGATAGGCCTTTTAGACATTTGGTTGTCTAAAAAAACATATTTAGTGTAATTTAACATTAGTAACACATACTATATGATCATTTCTCTTTTTTTTTGACATGCTTCCTCTCATGACAGCTAACTGCAGGTTAATTCTATAGCAGCATCACATTATCATTCAAAATAAAAAATGAAGTTAAAAAAATGACATGCACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34436
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084969 Nonsense 359 670 9 13
ENSDART00000136578 Nonsense 359 670 10 14
Genomic Location (Zv9):
Chromosome 8 (position 31983733)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31126459
GRCz11 8 31135691
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGGGGTCTCGATATATGCGCTGTTGAAGCACTGCATGGTAAAGACGGT[C/T]GAGATTACATAATAGAGGTAATGACATCTGCAAAAACAGGCAGCTTTTAA
Long Flanking Sequence:
GAATTCTCCCGATCCTCCCGATTAGCCAATCCGGGCCTGAGTGGGTCTATTCAATCATTAGCCTAACTTTGTGCTATTCTTAGACGTCTATTAGATCTTGACTGACAGCCCCCAAAATCAGCCTTGTTTTAGCCAAGACATCCACGCTAGACGTCTATTTGATTTCTAATAAACACAAAATGAATTGTCACATCTGATGTTTTAAACAGATATATCCCACATTTAAATCAGGTCAGTTTGTTCCATGTTTAGATTACATTTAAATCTAAACAGTCAATGACCCCTAGTCAAATATTAGTGTCTTGCACTGCAGTGATCCTGATTCCCTTGTTTGCTCTGGGTAGTGTACTGTTGGTGTGGGTGGCTGCTTTTAGTGGAATACACAAGGTCATCATTTGCACTTTTTCCCCTGCAGGTATCGTATGTGGGTGGATGTGTGCTCGGAGGTCTTTGGGGGTCTCGATATATGCGCTGTTGAAGCACTGCATGGTAAAGACGGT[C/T]GAGATTACATAATAGAGGTAATGACATCTGCAAAAACAGGCAGCTTTTAAAAGAATTAAACATATGCTTAGTGCCCTAGGCAAGCGCTCATTTCTGTCTCTTTCTGTGTTTGTTTATTAGGTGGTGGGCTGCTCAATGCCTCTGATTGGAGACCAGCAGGATGAGGACCGGGCTCTCATGGCTGACCTTGTTGTGGCTAAAATGAACGAGACAGTGCCACGCACTTCAGCTCCCACTACAGTCCGTTCTCAGGTTAACACTCTCACTTCAAAACATGCTCAAACTAAGCTCACTGGATATATGTGCATTCTAAATTATATCATGTTGTTTTTTGGAACATTTTGTGATGCAAACAAAGTAAAATGCTTAATTGTAGGCTCTAAATGCAAAATTTATAAGAAAGTTTTAATGTTAAGTTTTATTAGAAACAAATGAATGTAAATCTGGAATGCTTTCTTATGTTTGTTGCACTTAAAGATACAGTCAGAAAGAACAGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12369
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084969 Nonsense 480 670 12 13
ENSDART00000136578 Nonsense 480 670 13 14
Genomic Location (Zv9):
Chromosome 8 (position 31990192)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31132918
GRCz11 8 31142150
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCAATCCCAGTCTGTGACCAGCCCTATTGCTCAGAATCCACCTGCTCAA[C/T]AACCGCGGCCCAATCAACCGCCCCAGCGACAGGCCAGTCAAGGTTCAGCA
Long Flanking Sequence:
ATTTTTTGGTATTTGTTATGCAGCAAGCCCAGAGATTGTTGTGTACACTTTGGTTTTATATAAAAGTAACTTTAATGTGTGATAGGAATAAAACGTGGTCATATACGAATGATTTCTCCACTCAATGAATGGCGGCTTGGACCCGGAAACAGTATTACATACGTCACAAACACGTCACCACTTAACAAGCGGATACTTGCTACCCCCACTCTTTATTCTCTGCTGAATTGCAGAAGTCATTTGTAATATTATAAATGTCCTTATTTATCGTATATTTGACGAAAGCTGTTTACTTCACCAGCAAAATGAAGCAGATATTCCAACTATATTTTGCCCTGTAAGAATGAGCTCTTGTTTTAGGAGGCCCTCAACAAGCTGCTGCTAGCACTGCTGCTACCCGTCAAGGAGCACCACCACAGCAGCGGCCCTCTCCTCAAGGCCAGCCTCCTGCCCAATCCCAGTCTGTGACCAGCCCTATTGCTCAGAATCCACCTGCTCAA[C/T]AACCGCGGCCCAATCAACCGCCCCAGCGACAGGCCAGTCAAGGTTCAGCAGCTCCACAGAGGCCTCCTGCAGCACAGATACCTGCTCAGCGTGGCTCTCCTCAGTCACAGAGGCAAGGCGGACCCCAACAAGGTGGTCCTCAAACTGGTGGTCAGAGTCCCAAACCAGCCGGTCAGCCCCAACAGAGGCCTCAGCAGCCAAGACAAGGCCAGCCAACCAGGCAGCCTACCCAGGGTGGCCCACAGCAGACCCAGGACGCCCCACAGCCAGCCCCGCAAGGCAGTCCTCGTCCTCCTACCACACAACAACCACGGCCTACTGCACCGGGACAGGGAGGCCCAGGAGGCACACGCCCTCCCTTGCAGCAGAAACCCCAACCTCCACAGAAACCCAGTCCTGATCACCCTGCCTTGAGTGGATCACCGCAGCTTAAGTAAGATGTTTTTTGTCCTCTGTGTAATCGGCTTGAAAATGATAGGTTCCACTCACTGGATGTGAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3667
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084969 Nonsense 605 670 12 13
ENSDART00000136578 Nonsense 605 670 13 14
Genomic Location (Zv9):
Chromosome 8 (position 31990567)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31133293
GRCz11 8 31142525
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGGACAGGGAGGCCCAGGAGGCACACGCCCTCYCTTGCAGCAGAAACCC[C/T]AACCTCCACAGAAACCCAGTCCTGATCACCCTGCCTTGAGTGGATCACCG
Long Flanking Sequence:
CTGCTGCTAGCACTGCTGCTACCCGTCAAGGAGCACCACCACAGCAGCGGCCCTCTCCTCAAGGCCAGCCTCCTGCCCAATCCCAGTCTGTGACCAGCCCTATTGCTCAGAATCCACCTGCTCAACAACCGCGGCCCAATCAACCGCCCCAGCGACAGGCCAGTCAAGGTTCAGCAGCTCCACAGAGGCCTCCTGCAGCACAGATACCTGCTCAGCGTGGCTCTCCTCAGTCACAGAGGCAAGGCGGACCCCAACAAGGTGGTCCTCAAACTGGTGGTCAGAGTCCCAAACCAGCCGGTCAGCCCCAACAGAGGCCTCAGCAGCCAAGACAAGGCCAGCCAACCAGGCAGCCTACCCAGGGTGGCCCACAGCAGACCCAGGACGCCCCACAGCCAGCCCCGCAAGGCAGTCCTCGTCCTCCTACCACACAACAACCACGGCCTACTGCACCGGGACAGGGAGGCCCAGGAGGCACACGCCCTCCCTTGCAGCAGAAACCC[C/T]AACCTCCACAGAAACCCAGTCCTGATCACCCTGCCTTGAGTGGATCACCGCAGCTTAAGTAAGATGTTTTTTGTCCTCTGTGTAATCGGCTTGAAAATGATAGGTTCCACTCACTGGATGTGAAGGTTTCGATGATTCATAAGCATTTGGACATGTTTTTCTATTGATTGATGTTGTTTCGTAACCCATGCGAGTGAATACACCAGATGGTGCCCATTTTTCTCAGCTGTGCCTCAAATTGCATGACAAGATGATGGTATGATTGACAGTGGCTGTGTGAATTAGAGTAAAGCTATTAAGGTTAAATACAAACTTCAAAAATAGATGTATTCAGATTTAATTGCACTGAGCGCCTAATTTTGGGATCGGAACAACCAAAAATGTCATTTTGGGGTGGAGGAGAGATGATGTGAAATGGGACACAGAGGTCAGTTATGGCTAAATATATAGGTCTCCTCTTGTGCTAATTATTTGGATTATACCTGAACTTGGATCTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21335
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084969 Nonsense 608 670 12 13
ENSDART00000136578 Nonsense 608 670 13 14
Genomic Location (Zv9):
Chromosome 8 (position 31990576)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31133302
GRCz11 8 31142534
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGCCCAGGAGGCACACGCCCTCCCTTGCAGCAGAAACCCCAACCTCCA[C/T]AGAAACCCAGTCCTGATCACCCTGCCTTGAGTGGATCACCGCAGCTTAAG
Long Flanking Sequence:
GCACTGCTGCTACCCGTCAAGGAGCACCACCACAGCAGCGGCCCTCTCCTCAAGGCCAGCCTCCTGCCCAATCCCAGTCTGTGACCAGCCCTATTGCTCAGAATCCACCTGCTCAACAACCGCGGCCCAATCAACCGCCCCAGCGACAGGCCAGTCAAGGTTCAGCAGCTCCACAGAGGCCTCCTGCAGCACAGATACCTGCTCAGCGTGGCTCTCCTCAGTCACAGAGGCAAGGCGGACCCCAACAAGGTGGTCCTCAAACTGGTGGTCAGAGTCCCAAACCAGCCGGTCAGCCCCAACAGAGGCCTCAGCAGCCAAGACAAGGCCAGCCAACCAGGCAGCCTACCCAGGGTGGCCCACAGCAGACCCAGGACGCCCCACAGCCAGCCCCGCAAGGCAGTCCTCGTCCTCCTACCACACAACAACCACGGCCTACTGCACCGGGACAGGGAGGCCCAGGAGGCACACGCCCTCCCTTGCAGCAGAAACCCCAACCTCCA[C/T]AGAAACCCAGTCCTGATCACCCTGCCTTGAGTGGATCACCGCAGCTTAAGTAAGATGTTTTTTGTCCTCTGTGTAATCGGCTTGAAAATGATAGGTTCCACTCACTGGATGTGAAGGTTTCGATGATTCATAAGCATTTGGACATGTTTTTCTATTGATTGATGTTGTTTCGTAACCCATGCGAGTGAATACACCAGATGGTGCCCATTTTTCTCAGCTGTGCCTCAAATTGCATGACAAGATGATGGTATGATTGACAGTGGCTGTGTGAATTAGAGTAAAGCTATTAAGGTTAAATACAAACTTCAAAAATAGATGTATTCAGATTTAATTGCACTGAGCGCCTAATTTTGGGATCGGAACAACCAAAAATGTCATTTTGGGGTGGAGGAGAGATGATGTGAAATGGGACACAGAGGTCAGTTATGGCTAAATATATAGGTCTCCTCTTGTGCTAATTATTTGGATTATACCTGAACTTGGATCTCCTGACCTTGGTT
Associated Phenotype:
Not determined