Busch Lab

ZMP

slc12a9

Ensembl ID:
ENSDARG00000060366
ZFIN ID:
ZDB-GENE-050208-222
Description:
Solute carrier family 12 member 9 [Source:UniProtKB/Swiss-Prot;Acc:A2BFP5]
Human Orthologue:
SLC12A9
Human Description:
solute carrier family 12 (potassium/chloride transporters), member 9 [Source:HGNC Symbol;Acc:17435]
Mouse Orthologue:
Slc12a9
Mouse Description:
solute carrier family 12 (potassium/chloride transporters), member 9 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa33660 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38493 Nonsense Mutation detected in F1 DNA Not yet available
sa9521 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33660
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084917 None None 515 None 6
ENSDART00000139479 Essential Splice Site None 899 1 15
Genomic Location (Zv9):
Chromosome 5 (position 39848895)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37648285
GRCz11 5 38248438
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACTTTTTTTAACAAACAGAGGCAGGAGGTGGTACAGGCTCTGAGAGGG[T/G]ACGTTGCAGGTTACAACCATCATCACATCTCAATAAACCGTTATATAAGA
Long Flanking Sequence:
TACAAAATGCCTCATCAGGAGTCCAACATGACTGTATGAGTTGTTTCCACTTAACATAATTTAAGCGTTTTAAAAATTTGCTTCAAACATGAATAAAAGTTCACAATTGTGCATTTTCTGGTTATAGACCAGTTACTTTTATTGATACAACCATGTGCATCCTTTATAAATAAGAACTGAAACTACATTTTTTTAAAGTTTGGATGAATGCAGCACTTTCAATACATATAAATAATTAGGCTATTTTGTACCACTAAAGCATTTAAGTGCATTGTTTGTATTGTAAGTGCTTGCTGTAACCTGAGGTTTACATTTTATTTCTGATTAAATGTTCCACTAGTGAGATTTACGGGTGTATTATAACAAACCAAATGGTAAACAACACGGTTCCCACATGTTCCTCTGACTCTCTTTCCTCCGTAGAGTCACATGGGCGCTTCCTCTGTCCCGTGACTTTTTTTAACAAACAGAGGCAGGAGGTGGTACAGGCTCTGAGAGGG[T/G]ACGTTGCAGGTTACAACCATCATCACATCTCAATAAACCGTTATATAAGAGATGAATGTTTTGAAGAGGTCTGCTGTCTGTCGTTCACAGCCTGACACAGGAGCGCGTTTCACCATCCGTCATCATGATGATGATGTCCCGGAGGTTTGACGGTCACGAGATCTGAGGCTGCGGAAGAAACTTTCTACACGCGAGTCTTTGGACAAACGAAAGCTGCTCGGCGTGATGCTCTTATCGAACAGATAGGAGTCAGGACATCCCGGGTCCACATTATCAAAACGAGTATTTTGGTTTCCGTTGTTTTGTGCAGCTTCTTGAAAGCGGAAGTAAAACACCGCTTTTTTGGATTTGTCTTGGCGCTGTTATACGGACAGGTAGGTCGCGGTTGTTTCTCTTCACTTTAATTACTTCACCGCTATTTCTGTCTTGATAACCTCATCCACCCAACATCTGCTGGAGATCATGATGATGATGATGACGGTGGTCAGGAAATGTCAGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5311
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084917 None None 515 None 6
ENSDART00000139479 Nonsense 245 899 6 15
Genomic Location (Zv9):
Chromosome 5 (position 39841614)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37641004
GRCz11 5 38241157
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCACGCACACGTACGGCAACAACCACAGTGTTACGGTCAGTCCAAGCTA[C/A]ACGGGCTTTAACAGCACCACTCTGAAGAACAACCTTGGAYGTGAGTGATG
Long Flanking Sequence:
ATATTTTTAACTCTTGAGTCTCAGTCATGATCAGTCGTTCTCTGGGTCCAGAGTTTGGCGGGAGCATCGGCCTGATGTTTTACCTTGCGAAGGTGTGTGCGTGTGGTGTGTATGTTCTCGGGCTGGTGGAGGCCATAATGGACGTCTTCGGTCAGGATCCAGGTGAGCGCTGCACTGAAGCACACTGTACTAAAAGGTCATTGAATCAAATTAAGCGTCTCTGTTGTTCTCTCTCCAGGCTCTTCTGTGGCACAGGGGCTGCGTGTGTTGCCGCAGGGCTACTGGTACACCGTGTTGTACTCCTCTGTAGTGTTGTTGCTGTGTATGCTGGTGTGTCTGGTCGGTGCTCACATCTACGCCAAAGCCTCTTTTCTCATTCTGCTGGTGGTGACGGTGTCTCTGATCTCCATTATCATCAGCCCACTGATAGTCAGTCCACAGGGCTTTAACATCACGCACACGTACGGCAACAACCACAGTGTTACGGTCAGTCCAAGCTA[C/A]ACGGGCTTTAACAGCACCACTCTGAAGAACAACCTTGGACGTGAGTGATGTGTTTATCAATACAATAAGATCAATCTTTATTGATTCTGAACAATTTTTTTTCTCCAGAGTGCACTTTTTAAAAGAATACAATAAAGTTTAATGACGTAAAGAAAGAAAGACAGACAGAAAAAATATTGTACAATAATTACAGTTAATGAAGACTTTTGCTATTTTAAGGATGGAAAAATATGCACTGCGGTGCATGGTCTTATAGGGTTGTGCTTAAAGTATAACATTATTATTAAACGAATTAGAGTCTCATCTCTCATCTCCTTTAAGTTGTGTCGCGCCGTGGCACATTTGCTATTTACATGGCGGACTTCGTAAGAAAAAAAACTGAGCTCTTCACTAGCGAGAAAACAATTAAACACACCATCTGCAGCGAGGTTAAAGAATGAGCCTTCTCCATTCGGCCTCTTTACTTTCTCTTTACTTTACTTTTACTTTTTACTCCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38493
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084917 Nonsense 142 515 4 6
ENSDART00000139479 Nonsense 526 899 13 15
Genomic Location (Zv9):
Chromosome 5 (position 39825669)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37625059
GRCz11 5 38225212
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGATGGTCTTTCTGTGCTTCTTTAGGTGAGGAAGTACCTTCTGATGT[T/A]GGACTCTCGGAAGGATCATGTGAAGTTCTGGCGGCCGCAGGTGTTACTGA
Long Flanking Sequence:
TTATATCATCATATAATGCTGGGGGATTGGCTCTTTTGTCAACTTATATACAGTATATACTGTTCAGCCTGTACAGTCTCTGATCTTTTAAACCAATACCACAAAATAAGGTTGTGTATCTTTCATACTGTACAAAAATCTTTAATAATAGTTCATTCATTGCAAATTTTAGATTTCTGAATTAGAAATGTAATTTCTGTTTTATAAATGTATCAATGTGATCTGAGGTCTAACTACTAACCCTAAACTAAAACAGACAGTACTGATACTTGTGAAATACATGTTTGAAGCCATACTTTACTTTTACTTGAGTAAAAATGAGTACTTCACTTCATACAAGAATCATTTTAAACTCGAGTGTCTGTATTTCTACTCTAGTAAAGGATGTATGCCATCTCTTCTCTCTCTCACACATACACAACACATATGAATGTACTAAACTTCAAATTGATGAGATGGTCTTTCTGTGCTTCTTTAGGTGAGGAAGTACCTTCTGATGT[T/A]GGACTCTCGGAAGGATCATGTGAAGTTCTGGCGGCCGCAGGTGTTACTGATGGTGTCCAACCCACGCTCCTCCTGTCAGCTCATCTGCTTTGTCAACCAGCTGAAGAAAGGGGGCCTGTTTGTCCTTGGACACGTGCAGATTGGAGATCTGGGTAGGTTCAGACAAGGGTCAGGGGACAAATGTGTAATAGTTGGAGGAAGTTGCACAAAATTCATTGACCAAGATTTTGATCCTTAGCCAATTGCTGTTTTTGACCTACAGCTGAATACCAGATGTTTTAACCCCTTCCTCTTAAAGCCCAATGTACACTTCCTCACATGCATGCACACACACACACACAAACATGCATACATAAATGCACAGCTATTCTTATTATCCTAAGGGGTCCTCAAGGGAGTCAAATCTGGACTGGCCAGAACAGGCAGCTAGTATGGACCCTTTTCACATTTCCGAGGTCCCAGTAGTGTAAGTCATCACCGCTGGGTAAATTTAGAGCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9521
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084917 Nonsense 201 515 5 6
ENSDART00000139479 Nonsense 585 899 14 15
Genomic Location (Zv9):
Chromosome 5 (position 39821585)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37620975
GRCz11 5 38221128
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATTCTCTCTGGACWCTGTCTCCCAGATGTGCTGCCAGCAGACCCGGTG[C/T]AGCCGCAGTATAATTTCTGGTTGAGTCTGGTGGATAAGCTGGGTGTGAAG
Long Flanking Sequence:
CCAATGAATTAGTTTTGCAGACCTTTTGGCAGCTAATGTTTTGTTTTTGTGTTATTCCACAGTAAACTATTCATTTAAATCAGATTAGCTGTTAACTCAGGCTCATTCACCCTTATAGAGGACTTGCTCTTTCATTAAAATTCATGATACAGACCTGTATGACCAGTTTTCCTCTCTGAAACCTAAAAGAAGATATTTAGAAGAATTTTCTCAGCTGTCTCTTTGAGATCTGACAGAAAACCTTCATGCTCTTTAAAGTCTGTTTGCATTGCCATTTTTGAATGACTGTACAGCGAAGCGCATCAGAAATGCAGCATGTTGTCAATGGAAATGCCATGTTTTTTAAATGCTGGCAGTGTAGCCGGGCACTGACTTGTTTTATGGTCGGAGTTTTTTTTATTCATACCTGTAGAAATACCTGGAAATGGAAACAAGCAAACAAATAAGCATATATTCTCTCTGGACTCTGTCTCCCAGATGTGCTGCCAGCAGACCCGGTG[C/T]AGCCGCAGTATAATTTCTGGTTGAGTCTGGTGGATAAGCTGGGTGTGAAGGCCTTTGTGGATCTGACTCTTTCTCCCTCGGTCAGGCAGGGCACTCAACATCTGCTCCGCATCACTGGACTTGGTGAGACGTTCCTTATCACATTATCTTTACAGCGTGGAGCCAGAAAGCTGCTTTCAGATTAGATTTATCTGCATTGTTATTGTACAAAGTGCAAATGCATAGCAAGTGAATTAGTACAGTAAGTACAGTAATGTTATCTTTTCCACAGCTAGTTCAGAAACTGCAGCTGCTTCACAATATTAAACATCACTCATGTTGTTTTGACCCTTCCGACTCATCTTACATGAATACTATTTTTTGTATGTGTGCATAATTGAGAAGACACCAAAGAAATGTTTAATGTGAACTGATTTACATGGAAAACACAGAAATTTCATAATTTAAAAAAGAAAATGAATAAAGAGAACTTTGTAAGATAATTTTTAAGGTATTTGTGA
Associated Phenotype:
Not determined