Busch Lab

ZMP

si:ch211-147a11.5

Ensembl ID:
ENSDARG00000060361
ZFIN ID:
ZDB-GENE-060503-195
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1L9D2]
Human Orthologue:
KIAA0562
Human Description:
KIAA0562 [Source:HGNC Symbol;Acc:24866]
Mouse Orthologue:
BC046331
Mouse Description:
cDNA sequence BC046331 Gene [Source:MGI Symbol;Acc:MGI:2687282]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa38687 Nonsense Mutation detected in F1 DNA Not yet available
sa11679 Nonsense Available for shipment Available now
sa5770 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa38687
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084965 Nonsense 294 972 8 22
ENSDART00000135949 None None 144 None 4
ENSDART00000137645 Nonsense 270 712 8 15
Genomic Location (Zv9):
Chromosome 8 (position 22928405)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22299581
GRCz11 8 22320820
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGGCCGGTATGATGTGGAGAAACTCAGTGCAATAGAACGAGAGGACTA[T/G]GACACAGCCAAGCAGAAAAAGGAACAAATGGATGCTTACAGACTCGCAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27186
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084965 Nonsense 461 972 10 22
ENSDART00000135949 None None 144 None 4
ENSDART00000137645 Nonsense 437 712 10 15
Genomic Location (Zv9):
Chromosome 8 (position 22925043)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22296219
GRCz11 8 22317458
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTCACAGAAAAAGCTCAGAGAGAGGCCAGTCTGCCCATTGAAATATAT[G/T]GAGAGAGTCTGGTGAGACATGCAATATTCACATCTTCCAGTTGAATGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11679
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084965 Nonsense 473 972 11 22
ENSDART00000135949 None None 144 None 4
ENSDART00000137645 Nonsense 449 712 11 15
Genomic Location (Zv9):
Chromosome 8 (position 22922982)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22294158
GRCz11 8 22315397
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTCTTTCTCTTGTGTCTGTTAGGTGGCAGGAGCCTATTCCAAGACATG[G/A]TCCYACAGAGAGGATGCTTTGCTGGCAGTCCGCAAGAAACTGATGGAGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2469
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084965 Nonsense 622 972 13 22
ENSDART00000135949 None None 144 None 4
ENSDART00000137645 Nonsense 598 712 13 15
ENSDART00000084965 Nonsense 622 972 13 22
ENSDART00000135949 None None 144 None 4
ENSDART00000137645 Nonsense 598 712 13 15
Genomic Location (Zv9):
Chromosome 8 (position 22914482)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22285658
GRCz11 8 22306897
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGCTAGACWGGCACTGAGCAGACTGGAACTGATTGAGAAGCTTCTAGAA[C/T]AGCTGGGCACCAAGGACTCTGGCTTCACCCTTGACAGCATCATGCGGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5770
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084965 Nonsense 622 972 13 22
ENSDART00000135949 None None 144 None 4
ENSDART00000137645 Nonsense 598 712 13 15
ENSDART00000084965 Nonsense 622 972 13 22
ENSDART00000135949 None None 144 None 4
ENSDART00000137645 Nonsense 598 712 13 15
Genomic Location (Zv9):
Chromosome 8 (position 22914482)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22285658
GRCz11 8 22306897
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGCTAGACWGGCACTGAGCAGACTGGAACTGATTGAGAAGCTTCTAGAA[C/T]AGCTGGGCACCAAGGACTCTGGCTTCACCCTTGACAGCATCATGCGGGTA
Associated Phenotype:
Not determined