Busch Lab

ZMP

map3k3

Ensembl ID:
ENSDARG00000060348
ZFIN ID:
ZDB-GENE-070910-1
Human Orthologue:
MAP3K3
Human Description:
mitogen-activated protein kinase kinase kinase 3 [Source:HGNC Symbol;Acc:6855]
Mouse Orthologue:
Map3k3
Mouse Description:
mitogen-activated protein kinase kinase kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1346874]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa1697 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa1697
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084932 Essential Splice Site 263 620 9 16
Genomic Location (Zv9):
Chromosome 3 (position 31963547)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31694857
GRCz11 3 31826571
KASP Assay ID:
554-1643.1 (used for ordering genotyping assays)
KASP Sequence:
CGAACACACAGGATTAAGAGTTATCCTGACAACCGACAAGACTGCTCAGG[T/C]GCATYTCATATCAGTTGCTTTCCCGCTTAAGTTTTACAAATGAGCTGTTC
Associated Phenotype:
Not determined