Busch Lab

ZMP

si:ch211-284e13.4

Ensembl ID:
ENSDARG00000060330
ZFIN ID:
ZDB-GENE-060526-161
Description:
Novel protein similar to vertebrate insulin receptor substrate 1 (IRS1) [Source:UniProtKB/TrEMBL;Acc
Mouse Orthologue:
Irs3
Mouse Description:
insulin receptor substrate 3 Gene [Source:MGI Symbol;Acc:MGI:1194882]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa18812 Nonsense Mutation detected in F1 DNA Not yet available
sa33659 Nonsense Mutation detected in F1 DNA Not yet available
sa26532 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa2220 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa18812
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084890 Nonsense 112 513 2 7
ENSDART00000131831 Nonsense 123 1179 2 2
Genomic Location (Zv9):
Chromosome 5 (position 39692222)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37491612
GRCz11 5 38091765
KASP Assay ID:
2259-6232.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTATAATCTTACTGTCTTTTATTTTATATCTGTAGGTAAGACTCCTGAT[G/T]AGTGCGGCAGTGGAGGAGACTGTGGACTACCTTCCCCGGGCCCTGCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33659
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084890 None None 513 None 7
ENSDART00000131831 Nonsense 465 1179 2 2
Genomic Location (Zv9):
Chromosome 5 (position 39691196)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37490586
GRCz11 5 38090739
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAGTTACATCCTAATGGGTCACAGAGAAGGCTCTCACAAACGTGTTCAT[G/T]GACGCAGAGTCCTTCGCCGTTCATCTAGCCGCGAGTGTGAAGTTGAGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26532
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084890 Splice Site None 513 None 7
ENSDART00000131831 Nonsense 556 1179 2 2
Genomic Location (Zv9):
Chromosome 5 (position 39690923)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37490313
GRCz11 5 38090466
KASP Assay ID:
2259-6231.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGCAGGAAAACTCTGCAGATAAAGGTGTGAGTACAAAAGGGGGTCCT[G/T]AAGACTCCTCAATTGACAGTGGTTACATGTCCATGTTACCAGGCGTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2220
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084890 Nonsense 498 513 7 7
ENSDART00000131831 Nonsense 678 1179 2 2
Genomic Location (Zv9):
Chromosome 5 (position 39690557)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37489947
GRCz11 5 38090100
KASP Assay ID:
554-2778.1 (used for ordering genotyping assays)
KASP Sequence:
CCAGGTCAGCTTGCAGTACTCCTCCATCACACCCAGAGCAACAGCCACTG[C/T]AGCCAAAGATGGTCTATTCATATTTTTCAYTACCACGTTCCTACAAACAC
Associated Phenotype:
Not determined