Busch Lab

ZMP

si:dkey-193b15.3

Ensembl ID:
ENSDARG00000060326
ZFIN ID:
ZDB-GENE-070912-412
Description:
Novel protein similar to human and mouse microtubule-associated protein 1A (MAP1A) [Source:UniProtKB
Human Orthologue:
MAP1S
Human Description:
microtubule-associated protein 1S [Source:HGNC Symbol;Acc:15715]
Mouse Orthologue:
Mtap1s
Mouse Description:
microtubule-associated protein 1S Gene [Source:MGI Symbol;Acc:MGI:2443304]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa39884 Nonsense Mutation detected in F1 DNA Not yet available
sa10988 Nonsense Available for shipment Available now
sa10222 Nonsense Available for shipment Available now
sa17782 Splice Site, Nonsense Available for shipment Available now
sa32965 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39884
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098435 Nonsense 147 1294 4 9
ENSDART00000124217 Nonsense 144 1318 4 7
ENSDART00000124563 Nonsense 144 560 4 6
Genomic Location (Zv9):
Chromosome 2 (position 36646794)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36943504
GRCz11 2 36925961
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACAGGACAGTCTCTTGAAGACTCTGGAGATCTGGTCTTGCACACGGGG[C/T]AATTCACGCCAAATGATTTCACCCAGATCTTTTCAGATGAAGAGGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10988
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098435 Nonsense 378 1294 5 9
ENSDART00000124217 Nonsense 375 1318 5 7
ENSDART00000124563 Nonsense 375 560 5 6
ENSDART00000098435 Nonsense 378 1294 5 9
ENSDART00000124217 Nonsense 375 1318 5 7
ENSDART00000124563 Nonsense 375 560 5 6
Genomic Location (Zv9):
Chromosome 2 (position 36645886)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36942596
GRCz11 2 36925053
KASP Assay ID:
2259-2332.1 (used for ordering genotyping assays)
KASP Sequence:
TCCTAATGTACTACGAAGCAGTGATTTAGCAGGATTYATATTACAGCATT[T/A]GGAGAAACTGAAGATCTCACYAGAGCCCCTTTTTCGCAATTCAACTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10222
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098435 Nonsense 378 1294 5 9
ENSDART00000124217 Nonsense 375 1318 5 7
ENSDART00000124563 Nonsense 375 560 5 6
ENSDART00000098435 Nonsense 378 1294 5 9
ENSDART00000124217 Nonsense 375 1318 5 7
ENSDART00000124563 Nonsense 375 560 5 6
Genomic Location (Zv9):
Chromosome 2 (position 36645886)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36942596
GRCz11 2 36925053
KASP Assay ID:
2259-2332.1 (used for ordering genotyping assays)
KASP Sequence:
TCCTAATGTACTACGAAGCAGTGATTTAGCAGGATTYATATTACAGCATT[T/A]GGAGAAACTGAAGATCTCACYAGAGCCCCTTTTTCGCAATTCAACTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17782
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098435 Nonsense 585 1294 5 9
ENSDART00000124217 Nonsense 582 1318 5 7
ENSDART00000124563 Splice Site None 560 None 6
Genomic Location (Zv9):
Chromosome 2 (position 36645265)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36941975
GRCz11 2 36924432
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AARCAWTGCAAAACAAAACCCCTCCAGACTTGTTACAAGAAAGGAGTCTT[T/A]GAAGGACAAAAGCAGTGAAAAAACAAACAAATCAGACTCAAAGAAGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32965
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098435 Nonsense 711 1294 5 9
ENSDART00000124217 Nonsense 708 1318 5 7
ENSDART00000124563 None None 560 None 6
Genomic Location (Zv9):
Chromosome 2 (position 36644888)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36941598
GRCz11 2 36924055
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCCTCACCTGAAGATATGACAGCAGAATTTCTGCAAATGGATCGAGAA[C/T]AACACGAATTACTTGCGAAGAGTCAAGCTGTTGACTCTGGAAACCTGAAA
Associated Phenotype:
Not determined