Busch Lab

ZMP

si:dkey-4c23.6

Ensembl ID:
ENSDARG00000060325
ZFIN IDs:
ZDB-GENE-070705-319, ZDB-GENE-091112-10
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1MTC0]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa37525 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37525
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084871 Nonsense 108 507 2 11
Genomic Location (Zv9):
Chromosome 22 (position 25439495)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24939401
GRCz11 22 24967025
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCATCCGCTGTATAATTTGCCCACCCCACCTGTGCCTGATGGGGATTG[G/A]CTGCTGAAAGTCCGAACGAAAGTAAAAGAGCAAGAGCGAAGCACACAGCA
Associated Phenotype:
Not determined