Busch Lab

ZMP

si:ch211-139a5.8

Ensembl ID:
ENSDARG00000060297
ZFIN ID:
ZDB-GENE-060526-44
Description:
Novel protein similar to vertebrate glucocorticoid receptor DNA binding factor 1 (GRLF1) [Source:Uni
Human Orthologue:
GRLF1
Human Description:
glucocorticoid receptor DNA binding factor 1 [Source:HGNC Symbol;Acc:4591]
Mouse Orthologue:
Grlf1
Mouse Description:
glucocorticoid receptor DNA binding factor 1 Gene [Source:MGI Symbol;Acc:MGI:1929494]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8435 Nonsense Mutation detected in F1 DNA Not yet available
sa26529 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26530
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084819 Nonsense 351 1530 1 8
ENSDART00000138162 Nonsense 351 1517 1 6

The following transcripts of ENSDARG00000060297 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 39474542)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37274191
GRCz11 5 37874344
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGACGTCGTAAAGCATACTTGAGTGCTCTTCCACTCGCCTTAAGTAGCT[T/A]GGTGTCGGAGTTGGATGAAATTGAGCATTTAAGCTGGTCTGGGGTGCAAA
Long Flanking Sequence:
GTACAATCACTTAAGCAAGACAAAAAAGCCTATTGTGCTGGTTCTCACCAAGTGTGATGAGGGTGTGGAGCGATACATCAAGGATTCTCATACCTTTGCCATTACAAAAAAGAACCTGCAAGTTGTTGAGACTTCGGCTCGATCCAATATCAATGTTGACTTGGCTTTTCTTACCTTAATTCAACTCATTGATAAGGGAAAAGGTAAGCCTAAGATCATACCTTACTTTGAGGCATTGAAACACCAGAGTCAACTGATTGCCTCCGCAAAAGACCGCTATGAATGGTTGGTGAACCACATTGTGAAGAATCACAATGAAACTTGGCCAAACGTCAGCAGACGTATGCAGACTTCACCCGAATATAAGGAATATGTGTTTTTAGAAGGCACAGGTAAAGCTAAGAAACTATTTCAACAGCACATTCACCGACTTAAACAAGAGCATACTGAAAGACGTCGTAAAGCATACTTGAGTGCTCTTCCACTCGCCTTAAGTAGCT[T/A]GGTGTCGGAGTTGGATGAAATTGAGCATTTAAGCTGGTCTGGGGTGCAAAAAGTGCTTGAGTCTAAAAAAGACTTTGATCATTGGTTTGTGGTACTGGACGATGCACCATGGGAAGACACACCACATCTTGACAATATGGAGGATGACCGCATCCCCTTTGATGTGCTAGACACCACGGCTGCTGAAATCCTCTTTGATGCACACCTTGAACACTTGCGCAATGAATGCAAGCGTGCCCAGATGCGTCATGAGTTCAAAGGAAAATTAGCATCTTCACCTTTCGTTACTCCAGGCAAGCCCTGGGAGGAGGCTCGAAGCTTCATCATGAATGAAGACTTTTACCAGTGGCTTGAGGAGCCAGAATATTTGGACATTTATAACCGTCACCAGAAAGCAATCATTGACAGGGCAAAAGAGGATTTTCAGGAGCTTCTGCTGGAGTACTCTGAACTCTTCTACGAACTTGAGGTGGATGCCAAACCTAGTAAAGAGAAAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8435
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084819 Nonsense 490 1530 1 8
ENSDART00000138162 Nonsense 490 1517 1 6

The following transcripts of ENSDARG00000060297 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 39474126)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37273775
GRCz11 5 37873928
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTGGACATTTATAACCGTCACCAGAAAGCAATCATTGACAGGGCAAAA[G/T]AGGATTTTCAGGAGCTTCTGCTGGAGTACTCTGAACTCTTCTACGAACTT
Long Flanking Sequence:
AGCACATTCACCGACTTAAACAAGAGCATACTGAAAGACGTCGTAAAGCATACTTGAGTGCTCTTCCACTCGCCTTAAGTAGCTTGGTGTCGGAGTTGGATGAAATTGAGCATTTAAGCTGGTCTGGGGTGCAAAAAGTGCTTGAGTCTAAAAAAGACTTTGATCATTGGTTTGTGGTACTGGACGATGCACCATGGGAAGACACACCACATCTTGACAATATGGAGGATGACCGCATCCCCTTTGATGTGCTAGACACCACGGCTGCTGAAATCCTCTTTGATGCACACCTTGAACACTTGCGCAATGAATGCAAGCGTGCCCAGATGCGTCATGAGTTCAAAGGAAAATTAGCATCTTCACCTTTCGTTACTCCAGGCAAGCCCTGGGAGGAGGCTCGAAGCTTCATCATGAATGAAGACTTTTACCAGTGGCTTGAGGAGCCAGAATATTTGGACATTTATAACCGTCACCAGAAAGCAATCATTGACAGGGCAAAA[G/T]AGGATTTTCAGGAGCTTCTGCTGGAGTACTCTGAACTCTTCTACGAACTTGAGGTGGATGCCAAACCTAGTAAAGAGAAAATGGGAGCAATTCAAGAAGTGTTAGGTGAAGAACAACGCTTCAAGGCACTTCAGAAACTGCAAGCTGAAAGGGATGCTTTAGTACTGAAACACATCCATTTTGTTTATCACCCTACGAAGGAAACATGCCCAAACTGCCCACACTGTGTTGACAGCAAAATTGAGCAAATTCTAGCTTCATGCTTCCCTGCACAATATCCTTCCTTTGGAAAGTCGCATATAACTGATGCAAAGGTAGATAGGATCAATCTTGTTATACTGGGTAAAGATGGACTTGCTAGAGAATTAGCCAATGAAATTCGGGCACTGTGTACTAATGATGATCATTATGTGCTTGAAGGAAGAATGTATGAGCTTGTCCTTCGGCCAATTGAGGGCAATGTTAGACTTCCTGTTAATTCGTTTCATACATCCACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26529
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084819 Nonsense 1100 1530 1 8
ENSDART00000138162 Nonsense 1100 1517 1 6

The following transcripts of ENSDARG00000060297 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 39472294)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37271943
GRCz11 5 37872096
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCGCCGTTCCCTCACATCCAATGTGACGTGGCCTCTAGGAGGAGATTA[T/A]GATCCTTCAGACTATGCTGAGCCAATGGATGCTGTCTCTAAGCCACGCCC
Long Flanking Sequence:
GAAGGACGATTTGGCAGTATTGTCTGTGGTCATGGCGGCGTTGTTGGAGGACTACACAAACTAGACCTTTTAGAACAATTTTTCACAGAAGTATTAGAAAAGAAAACCATAGTTGAAGCCAGCCATATGTATGAAAGCATGGCAGAAGCCAGTAGCACAAATGAGAATGTGTATTCGCCACACTGTGGCTCCCCAAGCCCTGTCACAATGCTGTTAGATTCTGAGGAAGACATGGAAGCTTCCCCGCCTTACCATGATGGCACACTTACCTCTCACGGTGGATTCAAACTGCCTGACCTGGACTCAGGTGACACATTCTCTGTGATCTCTGACCTTAGCACCTTTGAGAACAAGCTAAATAATAAAGTTCCTCCACAAGTGAGACCCAAACCTAGTGTCACATTTGACCTTAGAAAGCCAAGTTTTAACCCCTATGTGGATGGAGTCAGCCACCGCCGTTCCCTCACATCCAATGTGACGTGGCCTCTAGGAGGAGATTA[T/A]GATCCTTCAGACTATGCTGAGCCAATGGATGCTGTCTCTAAGCCACGCCCCAGCTATGAAGACAGCATATATTCTGTGCCTCATGACAGCACACAAGGTAAAATTATTACTATACGCAATTCAAATCGAATCCACTCCAACGGAGGAGGAAATGGTTCAGACAGTGAAGGGGATGGCAGCTCATTGGAGAGACGTCGCAAGTTTTCAGCAGCAAGGGTTAAGCCACGGCTTTACCGTGATCGTTCCAAACGTCTGGGGAAGTTCAGCAGTTTCCGCACTAGTTTCTCTATTGGTAGCGATGATGAGATTGGCACACTCTCAAGGTCAAAAGAGGATGATGTTTCACCACTGAAGACAGATATAACAAATGAAGAAGGAGAAGATCCCAAAAAGAGAAACATCCTGAAAAGTCTCCGCAGACCAGGCAAAGTAAGTTTTTGAGTATATTATTTATCTTTTTTATACATTTTTAATTGAACTGTCTTTGGAGGCCTATAAAT
Associated Phenotype:
Not determined