Busch Lab

ZMP

si:ch73-107c13.2

Ensembl ID:
ENSDARG00000060260
ZFIN ID:
ZDB-GENE-081104-242
Description:
Novel protein similar to vertebrate farnesyl-diphosphate farnesyltransferase 1 (FDFT1) [Source:UniPr
Human Orthologue:
FDFT1
Human Description:
farnesyl-diphosphate farnesyltransferase 1 [Source:HGNC Symbol;Acc:3629]
Mouse Orthologue:
Fdft1
Mouse Description:
farnesyl diphosphate farnesyl transferase 1 Gene [Source:MGI Symbol;Acc:MGI:102706]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6657 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37183 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6657
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084724 Essential Splice Site 127 418 3 8
ENSDART00000133280 Essential Splice Site 156 179 2 3
Genomic Location (Zv9):
Chromosome 20 (position 53557855)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53118247
GRCz11 20 52923664
KASP Assay ID:
554-5382.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCCAGAGCAGAGAGAAGGACCGGCGCGTGCTGGAGGATTTCCCCACMG[T/A]CAGTACAACATCAACAACACACTCGAAACACTGCAGAACTTTTATTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37183
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084724 Nonsense 191 418 5 8
ENSDART00000133280 None None 179 None 3
Genomic Location (Zv9):
Chromosome 20 (position 53551633)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53112025
GRCz11 20 52917442
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTGGCGGGGCTGGTGGGCATCGGGCTCTCCCGGCTGTTCTCCGCATCC[C/T]AGCTGGAGGAGCCGGAGGTGGGCCGGGACACAGAGCTGGCCAACTCTATG
Associated Phenotype:
Not determined