Busch Lab

ZMP

si:dkey-255n6.2

Ensembl ID:
ENSDARG00000060256
ZFIN ID:
ZDB-GENE-100922-251
Human Orthologue:
ALKBH8
Human Description:
alkB, alkylation repair homolog 8 (E. coli) [Source:HGNC Symbol;Acc:25189]
Mouse Orthologue:
Alkbh8
Mouse Description:
alkB, alkylation repair homolog 8 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1914917]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa22924 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22924
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084715 Nonsense 113 666 2 11
Genomic Location (Zv9):
Chromosome 16 (position 44942897)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42223405
GRCz11 16 42173437
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCTCAATGGACGAACACTACAGTGTCAGGATCAGACCATGACACTTTA[T/A]TTCAGCTATGTTGTGAAAGGTGCATCACGCGGGACATATTTTAATAAACA
Associated Phenotype:
Not determined