Busch Lab

ZMP

sb:cb472

Ensembl ID:
ENSDARG00000060238
ZFIN ID:
ZDB-GENE-030521-32
Human Orthologue:
UACA
Human Description:
uveal autoantigen with coiled-coil domains and ankyrin repeats [Source:HGNC Symbol;Acc:15947]
Mouse Orthologue:
Uaca
Mouse Description:
uveal autoantigen with coiled-coil domains and ankyrin repeats Gene [Source:MGI Symbol;Acc:MGI:19198

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa31580 Nonsense Available for shipment Available now
sa40941 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40940 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10010 Nonsense Available for shipment Available now
sa9033 Nonsense Mutation detected in F1 DNA Not yet available
sa11696 Nonsense Available for shipment Available now
sa7073 Nonsense Mutation detected in F1 DNA Not yet available
sa10140 Nonsense Available for shipment Available now
sa15099 Nonsense Available for shipment Available now
sa20990 Nonsense Available for shipment Available now
sa7072 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31580
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 43 1385 2 21
Genomic Location (Zv9):
Chromosome 7 (position 35163066)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33557406
GRCz11 7 33828556
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGAAGGCAGTGGAGAGGAGGGAGGTGGACAAAGTCGCAGCAGTACTT[G/T]GAAAGAAGGGCATCATCCCCACTAAACTTGATGTTGAGGGCCGATCTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40941
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Essential Splice Site 130 1385 6 21
Genomic Location (Zv9):
Chromosome 7 (position 35151011)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33545351
GRCz11 7 33816501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGATGCCTGGGGGAATGTTTAGGAATATTATTATTGTTTGTCTTTTCA[G/A]TCATGGCCGGCTGCTCCTCCAGCGTGAAGCTGCTCTGTGACAGTGGCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40940
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Essential Splice Site 288 1385 12 21
Genomic Location (Zv9):
Chromosome 7 (position 35143928)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33538268
GRCz11 7 33809418
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTTTTTATTATTAGAGCTGACCATAGACATTTTCTGTATTAATAGAA[G/A]TTAGTGGACATTTAATGACTTTGTCTGCAATTGGCTGTGTGTTTTTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10010
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 439 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35141666)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33536006
GRCz11 7 33807156
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACTCTTCGCCAAGAGCTTGAATGTGCCCGCAGGCAGCAAGACGCTGCA[C/T]AAGAGGAAGTGGTCCACCTCCAAAAGGCTCTCGCAAGCAAGTCTCAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9033
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 472 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35141567)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33535907
GRCz11 7 33807057
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGTGAGGAGTTGACCAGGAAGTGTGAGACCATCAAGCGTGAGTCGGAT[C/T]AGCAGATACAGGAATTGGAAGAAGCCATGGGAGATGTGCAGAAGCGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11696
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 472 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35141567)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33535907
GRCz11 7 33807057
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGTGAGGAGTTGACCAGGAAGTGTGAGACCATCAAGCGTGAGTCGGAT[C/T]AGCAGATACAGGAATTGGAAGAAGCCAYGGGAGATGTGCAGAAGCGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7073
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 546 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35141345)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33535685
GRCz11 7 33806835
KASP Assay ID:
554-4522.1 (used for ordering genotyping assays)
KASP Sequence:
AAGGAGCTTCTGCTGAGGTTGGACGGGTCAGGAACCATTTAAAGCAGAGT[G/T]AGAAAGCGTTGGAGGAGTATAAGAAAAGTGAAGGGCTTCTGGCTGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10140
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 751 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35140730)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33535070
GRCz11 7 33806220
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAGGGYTCGATTAACAGAGGAGACCGAGAAGAACAAACAGGCTGAGGAG[C/T]ARATACGGAAGCTRCAGGAGGAGAAAACCTCTCTTTGTGAGAACATTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15099
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 814 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35140540)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33534880
GRCz11 7 33806030
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAATAGCCTACAAGATCAAYACCAGRAGAAAGTCAGTGAACTTGAGGGTT[T/A]GGCAKCTGAAAAGGCAACACTGAAGCAGAGCTTTGACACAAAGTTTGTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18874
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 858 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35140409)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33534749
GRCz11 7 33805899
KASP Assay ID:
554-6137.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTGGAGGAGGCTTTGGAGAAAGCTAAGATTGAAATCGCAAAGTTGGAA[G/T]AGGATTGTAGAGTTCGAGGCGAGGAGTTACAGCAGGCAAAAGAAGGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20990
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 1071 1385 18 21
Genomic Location (Zv9):
Chromosome 7 (position 35139770)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33534110
GRCz11 7 33805260
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGAGGGCTGAACTGGAGGAGCAAAATGCATTGTGCAATTCTGAGATA[C/T]AGAGTCTTCAGCAGAAACTCAATAGTGAGTTCATCCACCTTGAGCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7072
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074729 Nonsense 1353 1385 20 21
Genomic Location (Zv9):
Chromosome 7 (position 35137095)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33531435
GRCz11 7 33802585
KASP Assay ID:
554-4353.1 (used for ordering genotyping assays)
KASP Sequence:
TCATCTAAACAGGACGCTGAGAGGCAAYATAGAGAAGTGGTTTCAATTTA[T/A]CGAACTCATCTTCTCAGTGCAGCACAGGTAATTGTGTTTGAGTGTGCGTC
Associated Phenotype:
Not determined