Busch Lab

ZMP

atp2c1

Ensembl ID:
ENSDARG00000060197
ZFIN ID:
ZDB-GENE-060503-615
Description:
Novel protein similar to vertebrate ATPase, Ca++ transporting, type 2C, member 1 (ATP2C1) [Source:Un
Human Orthologue:
ATP2C1
Human Description:
ATPase, Ca++ transporting, type 2C, member 1 [Source:HGNC Symbol;Acc:13211]
Mouse Orthologue:
Atp2c1
Mouse Description:
ATPase, Ca++-sequestering Gene [Source:MGI Symbol;Acc:MGI:1889008]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12710 Nonsense Available for shipment Available now
sa17127 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12710
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084528 Nonsense 201 922 8 27
Genomic Location (Zv9):
Chromosome 16 (position 44391964)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41672472
GRCz11 16 41622504
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTGGCAGTTGACGAGTCCAGTTTGAYAGGTGAAACGACCCCCTGCACC[A/T]AGACCTCTGCCCCTCAACCGGCTGCCACCAATGGCGATATCGCWTCCCGC
Long Flanking Sequence:
GGGTGATAAGCATGCAGTATGAAGGCGTGGGATATGGGGGGAGGCAGTGATTAGGCTAACCTAAACTAAAAGTGCTCCCACCAGACCTGAAAATCGGCTGAATGGATTTCAAAATGGTAAAACTCAGCTATTTAACTCAAGGAGAATTGTAAAATGAGCCTATTTCTAAAATAAGTGGAGTGTTCTTTTAAACTCTTAAGGTATTTGTACACTGATTTCGGGGGTGAGGTGTCTGAATAACACTGTTGAGAACTTGGTTAGTAACTGTACTGTGGTGTTAGTAATCACAGACGAAAATTAGGGATTCAGTGTGCAATAATCTTTACACGGTTGCGGTCAAACACACCATTGACAATACTGCAAGTGGTTTAAGTACTAGTGCCTGAAATAGGAGCTTTGTTCAGATGGCCTGTTGGTGAAGCTGACCCTTCTCTGCCCTGCAGTCCACAGATCTGGCAGTTGACGAGTCCAGTTTGACAGGTGAAACGACCCCCTGCACC[A/T]AGACCTCTGCCCCTCAACCGGCTGCCACCAATGGCGATATCGCTTCCCGCAGTAACATTGCCTTCATGGGGACGCTGGTGCGCTGTGGGAAAGCCAAGGTACAGTTTCATCTGATACTTTCCCCCAAACAGAGTTCATTTATAGGCATACGTGTTCCCTACTGCTTAATGTTTGTGTTTTTTGATGTAATTGATGTAAAGAGTTTTGTGTCAATGTTTAAATAAGGTACAATTTCGCTTATTCACTGTGGGAAGACCAAGGTCTTTTTGATTGTTGTTGTTGATATTTGATGAATTAAACCAAATGTACTACCAAACTAACACATTGCTCAGCATAATACACCACATTTTGAAAATGAATATTTTGTATTAATTTCTCAGTGAATATAGGCAATGTATTTTGGTGCATTTAAAGAAAACAGATTTGTTAAACATATATATTTATTCCAATAATATTTTAGTCACCAAATATATTTAGACATGGAAACATAATACAATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17127
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084528 Nonsense 516 922 17 27
Genomic Location (Zv9):
Chromosome 16 (position 44375024)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41655532
GRCz11 16 41605564
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAAAGGCGTCACTATGCCTCTRAACAATCAGCAGAGAGACTTCTACCAA[C/T]AGCAGAAGAGCTACATGGGCTCTGGCGGTCTTAGAGGTAAATATTTGTCA
Long Flanking Sequence:
AAGGGGGTGGGGCATGTGAGATACTAGAGAGCGTTTGATTCGTCAAGATTTTATGAGATGACATTAAAAAAAAAAAAACGTTTTATCTATTTCATGGAATTGACAAGTTTTATGTTTATATTGGTTTTATATCTTCTAAACACAAATTTTGCCACTGTTTTGTACCACACCTGCGTATAGACATACCTGAAGACTAACATACTGATACTAACATCTAAAAAAACTTTATTTTAATTTCACTGCACCTTTAATGTCATGTAACAAACGGCTACTTTACATATGAATAAGACATTTCCTTTGTAAATAAGCAGTACTTTGTCAAAATAACCTGCAAAGTTATTCTGGTAGTTAACTAATTGTGTTTTCTTGCATTTACACAGGATAAGCCTGGCTTGTTTTATGTAAAGGGCGCCTATGAGCAGGTCATCCGCTTCTGTACATCCTACAACAGCAAAGGCGTCACTATGCCTCTGAACAATCAGCAGAGAGACTTCTACCAA[C/T]AGCAGAAGAGCTACATGGGCTCTGGCGGTCTTAGAGGTAAATATTTGTCATTATATTAGTCAAGAAATGACCACTTTAATTCTGCAGCGATGCATTAAAATGTTCAAATCCAGCATTAAAGACTTTATCCACCTTTTTTGTCGATGACTACTGTGGTTCGAGTTATAGTTTGCTCTTCCTGTTTGTAAATGTCTATTCTAGGGGCTCTAAATCTTGGTCCTGGAGGTCCGGTGTCCTGCAGTTTTTAGCTTAAACTCCAATCAGACACACCTAGGCTAGCTAATCATTCTCCTACTAGGCTTTTTAGAAACATCCTTGCAGGTGTCTTGAAGCAAGTTGGAGCTAAAATCTGCAGAACACCGGAACCTTCAGGACCGAGTTTGAGAATCCCTGGTCTATTCTATTATATTTTAATCTTTTCTATTGAACTCAACATTTAAAATGATCCATTTTAGTTTAACACTGTTTTATTGATGCATTTTAGTCAGAGAGTTACAGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28727
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084528 Nonsense 598 922 19 27
Genomic Location (Zv9):
Chromosome 16 (position 44369411)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41649919
GRCz11 16 41599951
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTGCTACAGCCAGTCGACTGGGCCTCTACACCAAAGGTTCACAGTGTT[T/A]GTCTGGAGATGAAGTTGACCAGATGGACATCCAGCATCTCTCACAGATAG
Long Flanking Sequence:
AAGTTCACTAGACATTATATAGCGCACTGTCCTATATTATATAGCCTCCTGTCCCGTGAACACGGATCATCTTTTCATTTCAGTCCATTTATTAGGAAATTAGTATTATCATTCATTCATGTCAATAAAGCAGCAAATCAATACATCACATAGCATTACACTTACCCAAGGCAAAGCATTCACTGTTAAAAAAAAACAAACTTTTAAATTAATGTTTAAAAAAATACACATTTTCATGCATTCTTGCTTTCATAATCACAAAATGTGTAGCTTTATATTATATACTGTATATTCCAATAAGCTGCAGGTCAATCAATAACAATCTAATGAAGCTTAATGGCTAAATAGAAAGTGTTTCAAATGATCAATAAAATATTATGGCAGCATCAAATCCATTGTAAACATCTGATGATTATTATGCCCTGTTCTCATCTGTTTAATCTGTTTGCTCTCTGCTACAGCCAGTCGACTGGGCCTCTACACCAAAGGTTCACAGTGTT[T/A]GTCTGGAGATGAAGTTGACCAGATGGACATCCAGCATCTCTCACAGATAGTGCACAGGGTATGAACACGCTTTCATTAACTCTAATCTCCTTCCAAAGCATTAAGATCCAAGAGGTCATCCGCTGGGTTTGGAATGGTTTCACGTCTACAGTATTCTTGGTTATTAGATGATACAAATGTGATAAAGTGATACTGGATTGAGTTTCTAACTCATTTTGGCCTCTAGCAATGTCTTTTTTTGTTTGTGTTTTCTTGGAAAGTGAAGTAACTCTATACTGTTCATAAGACTGTCATGACACCTTTATAATCATGATATGGCAATTTAGTCGAGGTCAAGAATAACATTAATGAAGCTGTTATAAAGTTCATGACAATTATAATGACCTCTGACAATCATTTTCGACAGATTTAGTACAAGTTATTTTGTCTTCATAATGTCAAGTTGTCATGATGAAGCCATCTTAAACAGTGTCATATTTGCATTTAAAAAGACATAATAT
Associated Phenotype:
Not determined