Busch Lab

ZMP

si:ch211-214c7.6

Ensembl ID:
ENSDARG00000060184
ZFIN ID:
ZDB-GENE-061207-17
Description:
Novel protein similar to H.sapiens PKN1, protein kinase N1 (PKN1) [Source:UniProtKB/TrEMBL;Acc:A2BGV
Human Orthologues:
PKN1, PKN3
Human Descriptions:
protein kinase N1 [Source:HGNC Symbol;Acc:9405]
protein kinase N3 [Source:HGNC Symbol;Acc:17999]
Mouse Orthologues:
Pkn1, Pkn3
Mouse Descriptions:
protein kinase N1 Gene [Source:MGI Symbol;Acc:MGI:108022]
protein kinase N3 Gene [Source:MGI Symbol;Acc:MGI:2388285]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa25649 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38288 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25649
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084512 Essential Splice Site 383 929 7 22
ENSDART00000132555 Essential Splice Site 358 904 6 21
Genomic Location (Zv9):
Chromosome 1 (position 46289257)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45126769
GRCz11 1 45818564
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGGCAGCGTTAGTGGAAAAACACCCCTCAAAACCGACGAACTCTCCTG[T/C]GAGTGTGTGAGGATGTCACGCTTCTAGTGCGTTTTGGCTGTAGTGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38288
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084512 Splice Site, Nonsense 494 929 11 22
ENSDART00000132555 Splice Site, Nonsense 469 904 10 21
Genomic Location (Zv9):
Chromosome 1 (position 46296501)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45134013
GRCz11 1 45825808
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTAACTTTTCTCTTTTGTGTATGTGTTTGTTTGTGATCATACACAGGT[A/T]AAGCATTTTTGCGAGCTCGACAGATGAACGTTGATATTGGCACATTCGTG
Associated Phenotype:
Not determined