Busch Lab

ZMP

slco1d1

Ensembl ID:
ENSDARG00000060181
ZFIN ID:
ZDB-GENE-030131-5044
Description:
solute carrier organic anion transporter family, member 1D1 [Source:RefSeq peptide;Acc:NP_001082802
Human Orthologues:
AC087309.1, SLCO1B1, SLCO1B3
Human Descriptions:
liver-specific organic anion transporter 3TM12 [Source:RefSeq peptide;Acc:NP_001009562]
solute carrier organic anion transporter family, member 1B1 [Source:HGNC Symbol;Acc:10959]
solute carrier organic anion transporter family, member 1B3 [Source:HGNC Symbol;Acc:10961]
Mouse Orthologue:
Slco1b2
Mouse Description:
solute carrier organic anion transporter family, member 1b2 Gene [Source:MGI Symbol;Acc:MGI:1351899]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa30489 Nonsense Mutation detected in F1 DNA Not yet available
sa38230 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30489
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084568 None None 599 None 12
ENSDART00000127944 Nonsense 418 682 8 13
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 22832)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76022734
GRCz11 4 77407436
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGTGGCGTCGGTTCTGGCTTTCTGTTCAATGCTCATCCAGTATTTCCTA[C/T]AGTGTGACAACTCACAAGTGGCGGGACTTACAGTCACGTACCAAGGGTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30490
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084568 Nonsense 522 599 11 12
ENSDART00000127944 Nonsense 605 682 12 13
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 29870)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76015713
GRCz11 4 77400415
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAAATGGGGTTTAAAGCAATGCGGCGGCAGAGGAGCGTGTCGAATCTA[C/A]GACTCCGGAGCCTTCAGGTTAGTAACTGTACTGTACTTCATTAAGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38230
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084568 Nonsense 536 599 12 12
ENSDART00000127944 Nonsense 619 682 13 13
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 39009)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76006265
GRCz11 4 77390967
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGAAGCACCGTTTTTGTCTTTCAGGAATGCTTTCTTGGGGTTAATTTA[C/A]GCCCTGTACAGCTCATCCTACCTGCTGTTTGGACTTCTCTACAACAGACT
Associated Phenotype:
Not determined