Busch Lab

ZMP

LOC568788

Ensembl ID:
ENSDARG00000060127
Human Orthologue:
ADAMTS3
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 3 [Source:HGNC Symbol;Acc:219]
Mouse Orthologue:
Adamts3
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3 Gene [

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa45225 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33692 Nonsense Mutation detected in F1 DNA Not yet available
sa9777 Essential Splice Site Available for shipment Available now
sa33693 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45225
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084411 Essential Splice Site 26 1071 3 23
Genomic Location (Zv9):
Chromosome 5 (position 46944182)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44725447
GRCz11 5 45325600
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATCCAACTTGTATTTACATGTAACACGACAAGAATTTTAATATAATCA[G/C]TGTTTGTCTTGTGTTATCTTAGATTTGTTGAAGAACCGTCTGAAAGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33692
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084411 Nonsense 32 1071 3 23
Genomic Location (Zv9):
Chromosome 5 (position 46944202)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44725467
GRCz11 5 45325620
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTAACACGACAAGAATTTTAATATAATCAGTGTTTGTCTTGTGTTATCT[T/A]AGATTTGTTGAAGAACCGTCTGAAAGAGTATGGCCTCATTACTCCCATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26561
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084411 Essential Splice Site 167 1071 4 23
Genomic Location (Zv9):
Chromosome 5 (position 46979845)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44761110
GRCz11 5 45361263
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTTGTTTTGTTTTGCTAACGGTCAGTCTTATTTTGTTTTCCAAA[A/C]GGCTGGAATGATCCGTACTGATTCTGATGAGTACTTCATTGAGCCTCTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26562
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084411 Nonsense 476 1071 11 23
Genomic Location (Zv9):
Chromosome 5 (position 47067103)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44848368
GRCz11 5 45448521
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTTCAAACATGACTGGCCGCAGCTCCCTGAACTCCCCGGCATCAATTA[C/A]TCCATGGATGAGCAGTGCCGTTTCGATTTTGGAGTTGGATACAAAATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9777
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084411 Essential Splice Site 582 1071 13 23
Genomic Location (Zv9):
Chromosome 5 (position 47073491)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44854756
GRCz11 5 45454909
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGTGGGATGGGTGTKCGCTTCAGAMCCCGCCAGTGCAACAACCCTGTG[T/C]AGGTTATACACTGATTTCACAGTCAGGATTGCTAKRAACACTTACTAAKA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33693
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084411 Nonsense 914 1071 21 23
Genomic Location (Zv9):
Chromosome 5 (position 47151955)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44926960
GRCz11 5 45527113
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACTCTTTTTGTCTCATGTCAGGTGGATCACCGAAGAGTGGGAACATTG[T/A]ACTAAAACATGTGGAAGCTTGGGATATCAAATCCGTACTGTGCGCTGTGT
Associated Phenotype:
Not determined