Busch Lab

ZMP

sybu

Ensembl ID:
ENSDARG00000060112
ZFIN ID:
ZDB-GENE-060929-1202
Description:
syntabulin [Source:RefSeq peptide;Acc:NP_001070641]
Human Orthologue:
SYBU
Human Description:
syntabulin (syntaxin-interacting) [Source:HGNC Symbol;Acc:26011]
Mouse Orthologue:
Sybu
Mouse Description:
syntabulin (syntaxin-interacting) Gene [Source:MGI Symbol;Acc:MGI:2442392]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa14587 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14587
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084381 Nonsense 308 628 9 9
ENSDART00000121756 Nonsense 186 506 5 5
ENSDART00000122081 Nonsense 326 634 9 11

The following transcripts of ENSDARG00000060112 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 41832434)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 39215884
GRCz11 16 39165916
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAGGAATGTCACCGTGTTGAAGCTCAGCTGGCTCTTAAAGAAGCCCGC[A/T]AAGAGATCAAACAGCTGCGCCAAGTGGTGGAAACCATGAAGAACAGCCTG
Associated Phenotype:
Not determined