Busch Lab

ZMP

si:dkey-146l2.1

Ensembl ID:
ENSDARG00000060102
ZFIN ID:
ZDB-GENE-060526-215
Description:
Novel protein similar to vertebrate ankyrin repeat domain 15 (ANKRD15) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
KANK1
Human Description:
KN motif and ankyrin repeat domains 1 [Source:HGNC Symbol;Acc:19309]
Mouse Orthologue:
Kank1
Mouse Description:
KN motif and ankyrin repeat domains 1 Gene [Source:MGI Symbol;Acc:MGI:2147707]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa45224 Nonsense Mutation detected in F1 DNA Not yet available
sa26558 Nonsense Mutation detected in F1 DNA Not yet available
sa2231 Nonsense F2 line generated Not yet available
sa2225 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45224
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084370 Nonsense 321 1335 3 12
ENSDART00000136521 Nonsense 321 1335 4 13
ENSDART00000145299 None None 187 None 3

The following transcripts of ENSDARG00000060102 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46537682)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44318947
GRCz11 5 44919100
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGGATGTTTCAGGAAGCGCTCCTTTAGCGTTGGCAGTGCTGATCAATA[T/G]GAGCCCCTGTCCCAGATCAAGACAGGTTCTGAGCTTCACATTGAGGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26558
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084370 Nonsense 471 1335 3 12
ENSDART00000136521 Nonsense 471 1335 4 13
ENSDART00000145299 None None 187 None 3

The following transcripts of ENSDARG00000060102 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46538130)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44319395
GRCz11 5 44919548
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCACCAGACCATCGAAGCCCTCAAAGAGAAGATTTACAGATTGGAGGTT[C/T]AACTTAAGGAGACGACCCACCAAATGGAAATGGGAAAGCTAAAGCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2231
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084370 Nonsense 609 1335 3 12
ENSDART00000136521 Nonsense 609 1335 4 13
ENSDART00000145299 None None 187 None 3

The following transcripts of ENSDARG00000060102 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46538545)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44319810
GRCz11 5 44919963
KASP Assay ID:
554-2916.1 (used for ordering genotyping assays)
KASP Sequence:
ATTAAGYGTATGTGAAATGGGAATCAACACGGAGTTAACAGCTGAAGGTT[T/A]AGGACTTTGCAAAAGAGAGGCTGAACAAGCCAAGGAGTTCAGGTCTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2225
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084370 Nonsense 696 1335 3 12
ENSDART00000136521 Nonsense 696 1335 4 13
ENSDART00000145299 None None 187 None 3

The following transcripts of ENSDARG00000060102 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46538805)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44320070
GRCz11 5 44920223
KASP Assay ID:
554-2873.1 (used for ordering genotyping assays)
KASP Sequence:
AGTTAACCAATACAGACAAGTTAGTTCTTACTGATACCTCCACCAATACA[C/T]AATCATGCTCAAAAGACAAACAAGTCGGCACCGAACCGTTAGAGACACGT
Associated Phenotype:
Not determined