Busch Lab

ZMP

kcnb1

Ensembl ID:
ENSDARG00000060095
Human Orthologue:
KCNB1
Human Description:
potassium voltage-gated channel, Shab-related subfamily, member 1 [Source:HGNC Symbol;Acc:6231]
Mouse Orthologue:
Kcnb1
Mouse Description:
potassium voltage gated channel, Shab-related subfamily, member 1 Gene [Source:MGI Symbol;Acc:MGI:96

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa40781 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40781
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084361 Nonsense 133 831 1 2
Genomic Location (Zv9):
Chromosome 6 (position 46496984)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46557918
GRCz11 6 46559800
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGAGCTGGACTACTGGGGAGTGGATGAGATCTACTTGGAGTCGTGCTG[C/A]CAGGCCAGATACCATCAAAAGAAGGAGCAGATGAACGAGGAGCTCAAGCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5384
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084361 Essential Splice Site 189 831 1 2
Genomic Location (Zv9):
Chromosome 6 (position 46496814)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46557748
GRCz11 6 46559630
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAATTATGGGATCTACTGGAGAAACCGGGATCGTCTGTAGCAGCCAAGG[T/C]AAACATCAGTATATACACTATAGCATCTTATCAGACTCAGACATAAACAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8244
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084361 Nonsense 274 831 2 2
Genomic Location (Zv9):
Chromosome 6 (position 46446467)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46507401
GRCz11 6 46509283
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTAAAGGTCCTCTTAATGTCATCGACCTGCTTGCCATCCTACCATATTA[T/A]GTCACCATATTCTTGACAGAGTCCAACAAAAGTGTACTGCAATTYCAGAA
Associated Phenotype:
Not determined