Busch Lab

ZMP

si:ch211-66i11.1

Ensembl ID:
ENSDARG00000060093
ZFIN ID:
ZDB-GENE-060526-177
Description:
death-associated protein kinase 1 [Source:RefSeq peptide;Acc:NP_001093460]
Human Orthologue:
DAPK1
Human Description:
death-associated protein kinase 1 [Source:HGNC Symbol;Acc:2674]
Mouse Orthologue:
Dapk1
Mouse Description:
death associated protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1916885]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa33687 Nonsense Mutation detected in F1 DNA Not yet available
sa45223 Nonsense Mutation detected in F1 DNA Not yet available
sa33688 Nonsense Mutation detected in F1 DNA Not yet available
sa14882 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33687
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084314 Nonsense 54 1439 2 25
ENSDART00000124059 Nonsense 54 1439 3 26

The following transcripts of ENSDARG00000060093 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46325381)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44106646
GRCz11 5 44706799
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGTATGCAGCCAAATTTATCAAGAAGAGGCGGAGCAAATCAAGCCGA[C/T]GAGGGGTCTCAAAAGACGACATTGAGAGGGAGGTCAGCATCCTGAAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45223
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084314 Nonsense 995 1439 24 25
ENSDART00000124059 Nonsense 995 1439 25 26

The following transcripts of ENSDARG00000060093 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46407489)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44188754
GRCz11 5 44788907
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCGAACCAGCTCATATCATGGCAACAGTTTGTTGTGGATGTGCAAGAA[C/T]AAATCAACCCTCTAGCCAGCGAAGAGGATCTGCGGGGACTGGCTTCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33688
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084314 Nonsense 1052 1439 25 25
ENSDART00000124059 Nonsense 1052 1439 26 26

The following transcripts of ENSDARG00000060093 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46411545)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44192810
GRCz11 5 44792963
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGCTCTGTAGTAACGTACTTGGCAAGCTTCTCTCAATTGAAACCCCC[A/T]AAGCAATCCACCATTATCGCGGCCGATACCGTGTAGAAGAGCTCCAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14882
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084314 Nonsense 1160 1439 25 25
ENSDART00000124059 Nonsense 1160 1439 26 26

The following transcripts of ENSDARG00000060093 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 46411869)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44193134
GRCz11 5 44793287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GYGGACTTTTCCATAAGTTACAGGTGAACTTGTGCAGGTGGAGCCGCCAG[C/T]AGAAGCCWGAGGTGGAGGCTGATGAWGTGAGGTTGTGGAGCGGTGGCGCT
Associated Phenotype:
Not determined