Busch Lab

ZMP

arid1ab

Ensembl ID:
ENSDARG00000060073
ZFIN ID:
ZDB-GENE-030131-5725
Description:
Novel protein similar to vertebrate AT rich interactive domain containing protein family [Source:Uni
Human Orthologue:
ARID1A
Human Description:
AT rich interactive domain 1A (SWI-like) [Source:HGNC Symbol;Acc:11110]
Mouse Orthologue:
Arid1a
Mouse Description:
AT rich interactive domain 1A (SWI-like) Gene [Source:MGI Symbol;Acc:MGI:1935147]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa325 Nonsense F2 line generated Not yet available
sa13632 Essential Splice Site Available for shipment Available now
sa9694 Nonsense Available for shipment Available now
sa13031 Nonsense Available for shipment Available now
sa11863 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa325
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084272 Nonsense 340 2135 2 20
ENSDART00000140747 Nonsense 340 2101 2 20

The following transcripts of ENSDARG00000060073 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30836693)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14528073
GRCz11 19 14390268
KASP Assay ID:
554-3340.1 (used for ordering genotyping assays)
KASP Sequence:
AGCAGCAGGGGCCTCCCCCTAGCTCACAGCAGGGTCCTCCTTACCCAGGG[C/T]AGGGTTATGGACCTCCGGGACCTCAGAGGTATCCCATGGGCATGCAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13632
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084272 Essential Splice Site 711 2135 6 20
ENSDART00000140747 Essential Splice Site 711 2101 6 20

The following transcripts of ENSDARG00000060073 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30865835)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14557215
GRCz11 19 14419410
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGTCCAGTCRGATGGTATGTTACATTCCTCCATGGGYCAGRATAGAGG[T/G]GAGTTTAGATYCATTTTCAGTAATGTTTTGTTATTTTTACAGTTTGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9694
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084272 Nonsense 748 2135 7 20
ENSDART00000140747 Nonsense 748 2101 7 20

The following transcripts of ENSDARG00000060073 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30867323)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14558703
GRCz11 19 14420898
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCGGCAAACATCTGGAAGCCAAATGCATGCTGGGATGGGTTCCTACCCA[C/T]AGAACAACTCCATGGGCAACTATGGGCCGCAGAGTGGCCAGTATGGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13031
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084272 Nonsense 762 2135 7 20
ENSDART00000140747 Nonsense 762 2101 7 20

The following transcripts of ENSDARG00000060073 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30867367)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14558747
GRCz11 19 14420942
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACCCAYAGAACAACTCCATGGGCAACTATGGGCCGCAGAGTGGCCAGTA[T/A]GGACCACAAGGTRAGAAGCTTGGGTTAGGCCGAAATAAATAGCTTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11863
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084272 Nonsense 1045 2135 12 20
ENSDART00000140747 Nonsense 1045 2101 12 20

The following transcripts of ENSDARG00000060073 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30874861)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14566241
GRCz11 19 14428436
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACWAATCTGAATGTGGGCACATCCAGTAGTGCGGCCAGCTCWCTGAAG[A/T]AACAGYACATCCAGTGTCTCTATGCCTTTGAGTGCAAGATCGAGCGAGGA
Associated Phenotype:
Not determined