Busch Lab

ZMP

A2RUY9_DANRE

Ensembl ID:
ENSDARG00000060071
Description:
LOC568678 protein [Source:UniProtKB/TrEMBL;Acc:A2RUY9]
Human Orthologue:
PAPD5
Human Description:
PAP associated domain containing 5 [Source:HGNC Symbol;Acc:30758]
Mouse Orthologue:
Papd5
Mouse Description:
PAP associated domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1917820]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa21016 Nonsense Available for shipment Available now
sa40953 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21015 Nonsense Available for shipment Available now
sa31582 Essential Splice Site Available for shipment Available now
sa12807 Nonsense Available for shipment Available now
sa21014 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21016
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Nonsense 176 653 2 12
Genomic Location (Zv9):
Chromosome 7 (position 39268897)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37605537
GRCz11 7 37876795
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTTCTCTCTCACTCTCTCCAGGCTGCATGAAGAGATAAAGGACTTTTA[T/A]GAGTACATATCTCCTCGTCCAGAGGAGGAGCAAATGAGGCATGAGGTGGT
Long Flanking Sequence:
AAGTGGTAGCAGTATAGAATTAGGATTGGGCCATAGTATTCTGACTTGTGGTAAATAGTATTTTTAATTGCCTACCTGTAAGCAAAAAAAAAAGTTTTATGTCATTTTGATTTGTTTATTGATTATATATATTGAAGAATTCATTGATTCATTGACCAAGCATGCACTAAATGAATAACTTGTAATAGAAATTGTAACATTCATATGTAAAGTACTTTATGTTTCAGGAATGGCTATTTTGATTGTGCACACTTTCGCATGTGCCATGTTATCGGGCTATTTATTGTTATGGAATAATGCTCTCAGTCAAGAAAACAGGCTTATCATAAACAACTTCAAATATGTGGTATTGTGCCGCCAAAACACCCAAGTATTTGTGTTAAACATTAAAGAGTTTTATTGCTAATCATCCAATCTCTCTTTGGGGAAGCAGATTATGTAACAATTATTAATTTCTCTCTCACTCTCTCCAGGCTGCATGAAGAGATAAAGGACTTTTA[T/A]GAGTACATATCTCCTCGTCCAGAGGAGGAGCAAATGAGGCATGAGGTGGTGGCCAGGATCCAGAGAGTCATCAAGGACTTGTGGCCCAATGCTGAGGTTGGTTTTACTCCTCCATGCTTAGTTTCTGTTGATGATTATGTGATCTTTATTCCTGCTTAATTCTTTCAATCAAGTGGTACCTGTAATCAACGAATAAATACAAACACTTGCATGTTTTCAGGTTTTACAGTTGACCTTTTAAAGGTCACAGATCAAATTTGTTCTTGCAGTAGTTCACCTTTACATTAATGTCATGGACATGCAGAGGAAAGAGCAGAGGTCTAATTATAGAGTCTTGGGGGACACCATTATTAAGTTGTAACTGGAACCTATCTAAAATACAAGACATCCTTTCCTCAGTTTATGTCTATATCTAAAATGATATGTTTAACAATTTAACTGTAAATTTGCATTATATGCAATGTTTATAATAGGCATTGCTCAGAACAGTCACATTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40953
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Essential Splice Site 208 653 2 12
Genomic Location (Zv9):
Chromosome 7 (position 39268800)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37605440
GRCz11 7 37876698
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGGCCAGGATCCAGAGAGTCATCAAGGACTTGTGGCCCAATGCTGAG[G/A]TTGGTTTTACTCCTCCATGCTTAGTTTCTGTTGATGATTATGTGATCTTT
Long Flanking Sequence:
TATGTCATTTTGATTTGTTTATTGATTATATATATTGAAGAATTCATTGATTCATTGACCAAGCATGCACTAAATGAATAACTTGTAATAGAAATTGTAACATTCATATGTAAAGTACTTTATGTTTCAGGAATGGCTATTTTGATTGTGCACACTTTCGCATGTGCCATGTTATCGGGCTATTTATTGTTATGGAATAATGCTCTCAGTCAAGAAAACAGGCTTATCATAAACAACTTCAAATATGTGGTATTGTGCCGCCAAAACACCCAAGTATTTGTGTTAAACATTAAAGAGTTTTATTGCTAATCATCCAATCTCTCTTTGGGGAAGCAGATTATGTAACAATTATTAATTTCTCTCTCACTCTCTCCAGGCTGCATGAAGAGATAAAGGACTTTTATGAGTACATATCTCCTCGTCCAGAGGAGGAGCAAATGAGGCATGAGGTGGTGGCCAGGATCCAGAGAGTCATCAAGGACTTGTGGCCCAATGCTGAG[G/A]TTGGTTTTACTCCTCCATGCTTAGTTTCTGTTGATGATTATGTGATCTTTATTCCTGCTTAATTCTTTCAATCAAGTGGTACCTGTAATCAACGAATAAATACAAACACTTGCATGTTTTCAGGTTTTACAGTTGACCTTTTAAAGGTCACAGATCAAATTTGTTCTTGCAGTAGTTCACCTTTACATTAATGTCATGGACATGCAGAGGAAAGAGCAGAGGTCTAATTATAGAGTCTTGGGGGACACCATTATTAAGTTGTAACTGGAACCTATCTAAAATACAAGACATCCTTTCCTCAGTTTATGTCTATATCTAAAATGATATGTTTAACAATTTAACTGTAAATTTGCATTATATGCAATGTTTATAATAGGCATTGCTCAGAACAGTCACATTTGACTGTTGTCCAATCACCTTATGTCTTTAAGCTGTATGAATATTAGAGACGCTTACATTTACCAGTCACAATTCAGTCAAATTCAAGATAATAGGGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21015
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Nonsense 220 653 3 12
Genomic Location (Zv9):
Chromosome 7 (position 39264698)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37601338
GRCz11 7 37872596
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTCTGATGGCAGGTTTGTGTGTTTGGGAGCTTCAGCACTGGCTTGTA[T/A]TTGCCAACAAGGTAATGCTATGATTTTTGTACTTTGTTTTTACCCACTAA
Long Flanking Sequence:
CAATTGTTCTCAATTACCCTCTCAGTATTACCTAAAGAACACAAATAGTTTGTCTCGCTGTAAGAAGATTATTCAACAGACCAGAGAGAGGCCTGACCTGCTATTTTTGAACCACATACAGTACAGGTTCATGTGCGAATTAATAATTCACTGCTTATTTAGTTTGCTTTTAAGCTTGATTTATGATCTGTGCTTGGCCAAATAGTTTATATATCATTTATATGTGTATGTATGTTTTTTAATTATTTTAAAAGTAAATCTTTTGTTTATGTGAGGGTACATCTAATCAGTTTCAGTCCTAGTGTGTTTTTGCAATTGCTTACAATTGTTCTCTCATACAGTCAGAATTGGGAGCATTACGTAAGGAACATCTTTCCTGTTTTCCATATAAAAATAAGAAGGGCTGTTGCATGATGGAGATTGACTTTACAGTTTCTGTTTGTTTTTTCTGTTTTCTGATGGCAGGTTTGTGTGTTTGGGAGCTTCAGCACTGGCTTGTA[T/A]TTGCCAACAAGGTAATGCTATGATTTTTGTACTTTGTTTTTACCCACTAAGTAATCTGAATAATATCTTAAAGCTATAGTTTACACAAAATAAGTTATTTTGAAAAATGTTAGAAACCTGTAACCACTGACTTCTATAGTAGAGAAAGAACAAATACCATGGAGATCAATGGTTACAGCTAACATTGTTCATCATGCTTAAATCTCTTTTACTGATGAATGACATGAAATGATGACAATCTTTTGAGTGAATTATCCTTTTAAATGACCTTCTCTATCCATGTTTTATTAGTTAAACGAAAGTCTGTTCTAAATCTTTTTAAGTAATATGCAAGTATTATAATATGCAGGTGTGTGCTTTTGTTCACATTTGTGTGTTTGCATTGAGGAAATTCAAATTTGGACTTTTTAGCTTCGCGTCTCCTGGGATTTTGAGTGTGTGCATTTTTTTCTTTGCGAGAGCCAATCTCTCGTTACTCAACACCGCTCAAACTGCATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31582
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Essential Splice Site 224 653 3 12
Genomic Location (Zv9):
Chromosome 7 (position 39264685)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37601325
GRCz11 7 37872583
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTTTGTGTGTTTGGGAGCTTCAGCACTGGCTTGTATTTGCCAACAAGG[T/C]AATGCTATGATTTTTGTACTTTGTTTTTACCCACTAAGTAATCTGAATAA
Long Flanking Sequence:
TTACCCTCTCAGTATTACCTAAAGAACACAAATAGTTTGTCTCGCTGTAAGAAGATTATTCAACAGACCAGAGAGAGGCCTGACCTGCTATTTTTGAACCACATACAGTACAGGTTCATGTGCGAATTAATAATTCACTGCTTATTTAGTTTGCTTTTAAGCTTGATTTATGATCTGTGCTTGGCCAAATAGTTTATATATCATTTATATGTGTATGTATGTTTTTTAATTATTTTAAAAGTAAATCTTTTGTTTATGTGAGGGTACATCTAATCAGTTTCAGTCCTAGTGTGTTTTTGCAATTGCTTACAATTGTTCTCTCATACAGTCAGAATTGGGAGCATTACGTAAGGAACATCTTTCCTGTTTTCCATATAAAAATAAGAAGGGCTGTTGCATGATGGAGATTGACTTTACAGTTTCTGTTTGTTTTTTCTGTTTTCTGATGGCAGGTTTGTGTGTTTGGGAGCTTCAGCACTGGCTTGTATTTGCCAACAAGG[T/C]AATGCTATGATTTTTGTACTTTGTTTTTACCCACTAAGTAATCTGAATAATATCTTAAAGCTATAGTTTACACAAAATAAGTTATTTTGAAAAATGTTAGAAACCTGTAACCACTGACTTCTATAGTAGAGAAAGAACAAATACCATGGAGATCAATGGTTACAGCTAACATTGTTCATCATGCTTAAATCTCTTTTACTGATGAATGACATGAAATGATGACAATCTTTTGAGTGAATTATCCTTTTAAATGACCTTCTCTATCCATGTTTTATTAGTTAAACGAAAGTCTGTTCTAAATCTTTTTAAGTAATATGCAAGTATTATAATATGCAGGTGTGTGCTTTTGTTCACATTTGTGTGTTTGCATTGAGGAAATTCAAATTTGGACTTTTTAGCTTCGCGTCTCCTGGGATTTTGAGTGTGTGCATTTTTTTCTTTGCGAGAGCCAATCTCTCGTTACTCAACACCGCTCAAACTGCATTTATACGTCACCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12807
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Nonsense 302 653 6 12
Genomic Location (Zv9):
Chromosome 7 (position 39261586)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37598226
GRCz11 7 37869484
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAAGWAGGTTTTTAATTTCTTMTTWCTTKTGTTTTTTGTTTAGCAATA[T/A]CCKGTGTTACCSTAMCTGGTGCTGGTTTTAAAGCAGTTTTTACTGCAGAG
Long Flanking Sequence:
ATGAGATTTCCTGATTAAAAATGGACAGAATTTTTGTTTTTATTATATCAACAAGATTAATTAATTATTTTTTTTTTTAACGAGATGAAGCTTCATGTGATTGTTGCAAAGGAAATGTTCTGTATAATGAAGAAGAGATCTTGAAATGGGACCAATTCAGGGAAATAAGAGTCAGTACTACAGATCTTAAAGTAAAGATGCATAAAATAAAGTTTCAGTTGAGCTCCTTCGGGTGCAGTGGTTAAAACAACATTGCATTTTTGTTTGGTACGTAAGCATATTGAAATGAAAGAGCACTTCGAATCTAAAAAAAGCAGTTCAATCTAAAACATCTGCCCCAAAGTGTTTTGTTTTTTAGTTCTTTGTAAATTGGTGTAAAAGCAACCATAAATTAATTCTCACTTGAGGCATGTAAAACAATTGCTCTGTGTTGCAGGTATAGTGTTAAAATGCAAGTAGGTTTTTAATTTCTTCTTTCTTGTGTTTTTTGTTTAGCAATA[T/A]CCTGTGTTACCGTACCTGGTGCTGGTTTTAAAGCAGTTTTTACTGCAGAGAGAGCTGAATGAGGTTTTCACAGGAGGAATCGGATCATACAGTCTGTTTCTCATGGCTGTCAGCTTCCTACAGGTAAGACATTTACTTCGAATCACACACACTCGCTAGTACTCTTAAATAAATCCTACTTGGCTGCTTGCATTATGCACTGCACCCAGACAGTTGAGTGTGACATTATAACAAAGGATTTTCATTTGGAACAAATACTTGTTGAATGTTTGTTTAAGCTTAAATGGTGTTTATTTAAGCTTTTTATTCTTTAAAGAATCTTGTGGTTCTTAAATATGGTATCAAATTTGCATATGATAAGAATTTCTGAATAATAATATGGCACTGAAGATTGGAGAACTGGCTGTGGATAATTCAGATTTTCCATAAGTAAGTTAAATTAAAATAGGTGAAATCAATTAAAATAGAAACTAATTAATTTATTATTAAAAATTATAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21014
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Nonsense 316 653 6 12
Genomic Location (Zv9):
Chromosome 7 (position 39261545)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37598185
GRCz11 7 37869443
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGCAATATCCTGTGTTACCGTACCTGGTGCTGGTTTTAAAGCAGTTTT[T/A]ACTGCAGAGAGAGCTGAATGAGGTTTTCACAGGAGGAATCGGATCATACA
Long Flanking Sequence:
ATTATATCAACAAGATTAATTAATTATTTTTTTTTTTAACGAGATGAAGCTTCATGTGATTGTTGCAAAGGAAATGTTCTGTATAATGAAGAAGAGATCTTGAAATGGGACCAATTCAGGGAAATAAGAGTCAGTACTACAGATCTTAAAGTAAAGATGCATAAAATAAAGTTTCAGTTGAGCTCCTTCGGGTGCAGTGGTTAAAACAACATTGCATTTTTGTTTGGTACGTAAGCATATTGAAATGAAAGAGCACTTCGAATCTAAAAAAAGCAGTTCAATCTAAAACATCTGCCCCAAAGTGTTTTGTTTTTTAGTTCTTTGTAAATTGGTGTAAAAGCAACCATAAATTAATTCTCACTTGAGGCATGTAAAACAATTGCTCTGTGTTGCAGGTATAGTGTTAAAATGCAAGTAGGTTTTTAATTTCTTCTTTCTTGTGTTTTTTGTTTAGCAATATCCTGTGTTACCGTACCTGGTGCTGGTTTTAAAGCAGTTTT[T/A]ACTGCAGAGAGAGCTGAATGAGGTTTTCACAGGAGGAATCGGATCATACAGTCTGTTTCTCATGGCTGTCAGCTTCCTACAGGTAAGACATTTACTTCGAATCACACACACTCGCTAGTACTCTTAAATAAATCCTACTTGGCTGCTTGCATTATGCACTGCACCCAGACAGTTGAGTGTGACATTATAACAAAGGATTTTCATTTGGAACAAATACTTGTTGAATGTTTGTTTAAGCTTAAATGGTGTTTATTTAAGCTTTTTATTCTTTAAAGAATCTTGTGGTTCTTAAATATGGTATCAAATTTGCATATGATAAGAATTTCTGAATAATAATATGGCACTGAAGATTGGAGAACTGGCTGTGGATAATTCAGATTTTCCATAAGTAAGTTAAATTAAAATAGGTGAAATCAATTAAAATAGAAACTAATTAATTTATTATTAAAAATTATAAGACTGTGCAAGTGAATAGGGTGAAAATAGCTAATAATAATAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5432
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084282 Essential Splice Site 493 653 9 12
Genomic Location (Zv9):
Chromosome 7 (position 39257746)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37594386
GRCz11 7 37865644
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCRCAGYGGGGTCAGAAGAGCAGCAAGGAGCCCGTTCTCAACTGYAATG[G/A]TGTGACATCCTCCATCAGCTCTTTAAATCTGTCTCTCKCTCTAGAAAACT
Long Flanking Sequence:
GCTGTTAAAAAGAAAGCATGTCAAATTGCACGAAAACAATCAGTGAAACTGCAAGGCTGTTAAAAGTGAACTGTGTTGTAGCGAGGGACCACTGTATTAATAGTTGTTTGTGAATTCTTTTTTTATTGGTTCTAAATGATGCAAAATAGTGCAAGAAAATTAAGTTATAATCCAAATATTAAGTTGTAATCTACCATCATTTAATTATTCTTTATTCATTGTTTAGCTTAATATTAAGTGTCACTGTATGTGAAGTGTAAGCACTGATCCGTACACACAAACATGCCCAGAGTAAGAAAAGGAGGAATCAAATTCTGCCACAGAAATGTGTTAAACTCAGGATGTGCTCGGGATAGGGTTGATGACTGGTCTTATCCTCTCCTCTCACAGTATTCTGGGTCGAATAATCCGCGTCACACAGGAGGTGGTGGAGTATCGTGACTGGATCAGTGCGCAGTGGGGTCAGAAGAGCAGCAAGGAGCCCGTTCTCAACTGCAATG[G/A]TGTGACATCCTCCATCAGCTCTTTAAATCTGTCTCTCGCTCTAGAAAACTGACGAACCCTTCTCTGTTTGTGCACAGCCAATGATCTCACACTGCTGGTTGAGCGTGAGGAGCTTGATGAGTGTAATAATAACCTTTCAGAGGACAGTGTGGTGTGTACATCTGTCCCCCGCAGCAAAGTGTCCTCCAACTCTTCGTCTCCTTCCCCTTCTTCTCCTTCATCACCGTCGTCATCCTCCTCTTCCCCGTCTTCAACGGCCTCTAGCTCAAGCGATGCGGTAAGAACATTTTCTAGTTGAAACAAGTAAATAAAATTCTTTCTGCAAATAATCATGATTGTTTTCTTATTAAACTATCTATTTATTTGAATCCATTTCAGTTTGATGTTGCCATGTTTTTACCTTATATAATTTCTTTTACCTTTATAATTATATAGGCTCACTCTGTATGTATTGGAGAAATATTATGTTTGTCTCAAATTGTTTTCTTTCTGTAGGACTC
Associated Phenotype:
Not determined