Busch Lab

ZMP

adcy7

Ensembl ID:
ENSDARG00000060070
ZFIN IDs:
ZDB-GENE-040713-1, ZDB-GENE-040713-1
Description:
adenylate cyclase type 7 [Source:RefSeq peptide;Acc:NP_001159744]
Human Orthologue:
ADCY7
Human Description:
adenylate cyclase 7 [Source:HGNC Symbol;Acc:238]
Mouse Orthologue:
Adcy7
Mouse Description:
adenylate cyclase 7 Gene [Source:MGI Symbol;Acc:MGI:102891]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa21013 Nonsense Available for shipment Available now
sa30635 Nonsense Mutation detected in F1 DNA Not yet available
sa1489 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21013
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084266 Nonsense 257 1043 5 24
ENSDART00000129156 Nonsense 257 1083 5 25
Genomic Location (Zv9):
Chromosome 7 (position 39188435)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37525075
GRCz11 7 37796333
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCCATGAAGATGAAGTTGGCCATTATGGAGCGCTGCAAGTGCAAAGAT[A/T]AAGAAGAACAGCAGCGGATGGTCCGGGACAACAACTTCCACAGTCTTTAT
Long Flanking Sequence:
TTTGACTCCATTGTTCATTCATCTTCAGAGTTGACAGCTGAATATTCACTTGTCATTGAAAACTTAATCAGTGTATCTTCCTAAATAGATTCACCGTTTTATAATTCAATTTGTTGTGTCCTTTTTCATTCAGAGGAGTTGTTGTTTCACTGTTTGTTTTGATTGTTGTCGGGGAAGTGACATCATGTAAAGCGAACAGTGAAAAGCAAGTTACAGTTTAATGGCAGGCTGTTAACCTCTCTGACAACAGTGCATGTTGAATATAGTCGATCTCTGAAACAATGCCCTGATGTTGAACCCTGAAGACAAACATTTCTACCCACAGGGTAACAGTGAAGACAGTACTTTGGATACAATATAATGTGGCTTTCACAGTAAACTTCAAACCTTTAAATGTGTTTTTGCTTGTCCTGTAGGAAAACCTTTTACAGTCAGTGCTTCCTGTGTACATCTCCATGAAGATGAAGTTGGCCATTATGGAGCGCTGCAAGTGCAAAGAT[A/T]AAGAAGAACAGCAGCGGATGGTCCGGGACAACAACTTCCACAGTCTTTATGTGAAGAGACATGAGAACGTCAGGTAACACACACACACACACACACACACACACACACACACACACACACACAATCACAGACTCATAGAAATCTAGAGCTGCTTGCGTGTTGTTCTGTGTTTTCCAAGCTCTAATTTAGCCCTTCCTCATTAATCAAGTGCTGATAGCGAATGAATGGTCAGTCTGTTAGCCCCGACTCTCAGAGTGCTCATCATGAGGACACTCATTTAATTAGTTTTATTTCCCATCAACCCCAAGAGTAGAGAGGGGGGCTGGGGTGCATCTATTAATATTCTAAGTCCCATGCCCACAATGCTCCGTTCTCAGGCAGCCGTTTATATTTAGAAAGGTTGCTTGTTTGCCTCCCTTTACAGCTGCTCCAGCAGTACACAGATTCACTCACCTGTGCGTGTGTGTGTGTGTGTGTGTGTGTGTTAGAGAGAGAGAACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26995
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084266 Essential Splice Site 319 1043 7 24
ENSDART00000129156 Essential Splice Site 319 1083 7 25
Genomic Location (Zv9):
Chromosome 7 (position 39185384)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37522024
GRCz11 7 37793282
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTTGTTCATGAAGATTTATAGATTGTGCTTTTGTTTGTGTCTCCTGTA[G/T]GAGAATGAGTGTATGCGGATAAAGATTCTTGGTGACTGTTACTACTGTGT
Long Flanking Sequence:
TTGTCTACAATTCTTTTAAGTCTAATTGATGCAATGTGTGGCATTGTTTTTAATTTCTCAAATAACTACATATGTCAGAAGACGCTGACGATGCTCAAAATGTATCTGCCACAAATTGAGGAAGAAGGTTTCCAAATGACCTTAACCTGTGTATAATGTCTTTGCTCTAGAGTAAACTTTACAGAGCAGTTTCCCTCCCTGTTCTTCCTTTTTCAAGACAAACTTGGACAAAAATAAGACTAAACTTTGTCACATTGCATAAGGTTGTTGAAACAATGCCACAGCGAATTCACACAAGAAGGTCGGGCGAATTATTTCTTTTTTAGCCGGGCAGTGTAATATAATTTAATTTATTATAATTTAATCTGATTATCAGTCGGTTTAGTTCTTAAACAAAAACATCATTGATGAGCTGGTAAATTAGATGCTTGTGCTTTGAATTTTACGTAATAGTTGTTCATGAAGATTTATAGATTGTGCTTTTGTTTGTGTCTCCTGTA[G/T]GAGAATGAGTGTATGCGGATAAAGATTCTTGGTGACTGTTACTACTGTGTGTCTGGCCTCCCCGTTTCCTTGCCAAACCACGCTAAAAACTGTGTTAAAATGGGCCTGGACATGTGTGAAGCCATTAAGTAAGTGTATAGTTTTAAATAGAATATACATCCACAATATCATTAACACAGCATCTCTTATTATGTTTTCTTTTTCTATTTTGGCACTGGCCAAGATATAAGGCAGATGACAGGTTGAATATTTTTCTAATCATCACTTGCAGGCAGGTGCGTGAGGCCACAGGTGTGGATATAAACATGAGAGTGGGTGTGCACTCTGGAAACGTCCTCTGTGGTGTGATTGGCTTACGAAAGTGGCAGTTTGATGTTTGGTCACATGATGTCACCTTGGCCAATCATATGGAGTCAGGTGGATTACCAGGGTATGAACAATAAAATACTTTTAAAATGACAAGTGTTTTGTTGCATATAGATAACTGTTTGGCTCATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30635
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084266 Nonsense 334 1043 7 24
ENSDART00000129156 Nonsense 334 1083 7 25
Genomic Location (Zv9):
Chromosome 7 (position 39185336)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37521976
GRCz11 7 37793234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGGAGAATGAGTGTATGCGGATAAAGATTCTTGGTGACTGTTACTACTG[T/A]GTGTCTGGCCTCCCCGTTTCCTTGCCAAACCACGCTAAAAACTGTGTTAA
Long Flanking Sequence:
TTTAATTTCTCAAATAACTACATATGTCAGAAGACGCTGACGATGCTCAAAATGTATCTGCCACAAATTGAGGAAGAAGGTTTCCAAATGACCTTAACCTGTGTATAATGTCTTTGCTCTAGAGTAAACTTTACAGAGCAGTTTCCCTCCCTGTTCTTCCTTTTTCAAGACAAACTTGGACAAAAATAAGACTAAACTTTGTCACATTGCATAAGGTTGTTGAAACAATGCCACAGCGAATTCACACAAGAAGGTCGGGCGAATTATTTCTTTTTTAGCCGGGCAGTGTAATATAATTTAATTTATTATAATTTAATCTGATTATCAGTCGGTTTAGTTCTTAAACAAAAACATCATTGATGAGCTGGTAAATTAGATGCTTGTGCTTTGAATTTTACGTAATAGTTGTTCATGAAGATTTATAGATTGTGCTTTTGTTTGTGTCTCCTGTAGGAGAATGAGTGTATGCGGATAAAGATTCTTGGTGACTGTTACTACTG[T/A]GTGTCTGGCCTCCCCGTTTCCTTGCCAAACCACGCTAAAAACTGTGTTAAAATGGGCCTGGACATGTGTGAAGCCATTAAGTAAGTGTATAGTTTTAAATAGAATATACATCCACAATATCATTAACACAGCATCTCTTATTATGTTTTCTTTTTCTATTTTGGCACTGGCCAAGATATAAGGCAGATGACAGGTTGAATATTTTTCTAATCATCACTTGCAGGCAGGTGCGTGAGGCCACAGGTGTGGATATAAACATGAGAGTGGGTGTGCACTCTGGAAACGTCCTCTGTGGTGTGATTGGCTTACGAAAGTGGCAGTTTGATGTTTGGTCACATGATGTCACCTTGGCCAATCATATGGAGTCAGGTGGATTACCAGGGTATGAACAATAAAATACTTTTAAAATGACAAGTGTTTTGTTGCATATAGATAACTGTTTGGCTCATTATGTCAGTTGTTTAGTGCTAATTGTTGCATTTTTTAAATTTATATATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1489
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084266 Essential Splice Site 916 1043 22 24
ENSDART00000129156 Essential Splice Site 956 1083 23 25
Genomic Location (Zv9):
Chromosome 7 (position 39166426)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37503066
GRCz11 7 37774324
KASP Assay ID:
554-1414.1 (used for ordering genotyping assays)
KASP Sequence:
TGTATCTGTGGTGTAGTTTGTGCTTGACCGKCTCTGTTGTGTTTGCCTCC[A/G]GGACCGTGAGCGGCAGAATGCACAGATAGGAAACATGGTGGAGTTCGCCA
Long Flanking Sequence:
AATCTATAATGAAATTGAATTTCAAAAGCCTGAAAGAAACAGAACTTAAATGGACTGATGTTTTTTTGTTCATCATTGTAAGCTGCTGCCTGTAATTACAGTGACAGGTCCTTGAATTAACAAATCTTTTCTTGAATATCAATTACTTTAGAGATTTGCATGAGAAGTGAACATAGTTGAGAATTAACATACTAAAAGTAATTATCCATTCCAAGAATCTCGTGCCAGGTTTTCAATTCGCCTTGACTGTACTATGGTACTGTAAATGAAAAGGATCTTTTCAAGACTGTCCAGCGCTTGTGAATGAGGTGCCCTTAATGAATGGCATTATAAAGGTAGTAGCTTGCATATTTTACAACCAAATGAAAAGAAAAGTTCCTTTTATTTATGCAGGTCATCTACTTCTCTGACCTCTAGTCACCCTGAGTATTCTAGGAGCTCCATAATGACTGTATCTGTGGTGTAGTTTGTGCTTGACCGGCTCTGTTGTGTTTGCCTCC[A/G]GGACCGTGAGCGGCAGAATGCACAGATAGGAAACATGGTGGAGTTCGCCATCGCTCTAATCGGCAAATTGGATGGCATAAACAGGCATTCCTTCAACACATTCAGGCTTCGTGTTGGTAAGTGAACAAAACTCAGTTCTCAGTCAGTGTTCATCTCTTAGTTACTGTTTGGGTTCTGAATTAACTTGGTGACTCACTTTGCAAACTCTGCATTAAAGATGCCATATACTGCATTGATTCATTAAGAACAATTTTTCTTTGATATCTACATAGCATTATGTGGCTTAGATAAGATCAAACATTTTCCAGAAATTGTTTTATATTCTCATTTAGAGTATTACCCCAAAAAACGCTCCTAGAATTAGAAGAGTGAATATTATTGAGCTCTGCTCTGACGCGCAGCTCTCCATGCCTGCTTTCTCTTTCACTTCCTCTCTCTCTCTCTCACTCACACACAGCATGATGCACTCTGAAACAAACATGTGCAAAATAATATTAACA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461