Busch Lab

ZMP

fam98b

Ensembl ID:
ENSDARG00000060068
ZFIN ID:
ZDB-GENE-061201-63
Description:
hypothetical protein LOC780841 [Source:RefSeq peptide;Acc:NP_001073130]
Human Orthologue:
FAM98B
Human Description:
family with sequence similarity 98, member B [Source:HGNC Symbol;Acc:26773]
Mouse Orthologue:
Fam98b
Mouse Description:
family with sequence similarity 98, member B Gene [Source:MGI Symbol;Acc:MGI:1915465]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa36547 Nonsense Mutation detected in F1 DNA Not yet available
sa32177 Nonsense Available for shipment Available now
sa13030 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36547
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084268 Nonsense 40 358 2 8
Genomic Location (Zv9):
Chromosome 17 (position 53164478)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52550045
GRCz11 17 52636345
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCTGGCCGAGTGTGGGCGGGGCTTCAGCTCATCTGAATATGTTAATT[T/A]GCTGACGTGGCTCACAAAACAACTGACACAATTCACTGAGACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32177
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084268 Nonsense 204 358 6 8
Genomic Location (Zv9):
Chromosome 17 (position 53162486)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52548053
GRCz11 17 52634353
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTTCAGGAGGAGCTGGAGAAGATCAACAGCACTCTGTCGGCGGAGTA[C/A]GAGTGCCGGCGGCGGATGCTCATCAAACGCCTCGACGTCACTGTGCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13030
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084268 Nonsense 325 358 8 8
Genomic Location (Zv9):
Chromosome 17 (position 53160459)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52546026
GRCz11 17 52632326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCACCTGGAGGAAGAGATCTGATGGAGGAGRAGGACRAGGGGCGGGATA[T/G]AGAGGAGGAGGAGGNNNNANNNTGGCAGACKGGTGGAGGAGAYGGCTGGAGGAC
Associated Phenotype:
Not determined