Busch Lab

ZMP

cylda

Ensembl ID:
ENSDARG00000060058
ZFIN ID:
ZDB-GENE-061108-2
Human Orthologue:
CYLD
Human Description:
cylindromatosis (turban tumor syndrome) [Source:HGNC Symbol;Acc:2584]
Mouse Orthologue:
Cyld
Mouse Description:
cylindromatosis (turban tumor syndrome) Gene [Source:MGI Symbol;Acc:MGI:1921506]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa21010 Nonsense Available for shipment Available now
sa7600 Missense Mutation detected in F1 DNA Not yet available
sa18879 Nonsense Available for shipment Available now
sa16446 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21010
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084249 Nonsense 199 951 2 16
Genomic Location (Zv9):
Chromosome 7 (position 38934446)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37271086
GRCz11 7 37542344
KASP Assay ID:
2259-9171.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTCGTTGTGAAGATGAATGTGGGGTCTTTGTTGCACTGGATAAACTT[G/T]AGCTCTGGGAAGATGAGGAGTTGGAGGTGGATCGTGTGACGCTGGAGGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26994
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084249 Nonsense 500 951 6 16
Genomic Location (Zv9):
Chromosome 7 (position 38925691)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37262331
GRCz11 7 37533589
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGGTGGGTTGGTCTCCCTCCAGGACTACAAGAGTCACTAGCTGGACTA[G/T]AGCTGGTTAGTACATTTGTGTGTGTTTGCTAAACTGTAACTATTATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7600
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084249 Missense 679 951 11 16
Genomic Location (Zv9):
Chromosome 7 (position 38913065)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37249705
GRCz11 7 37520963
KASP Assay ID:
554-4257.1 (used for ordering genotyping assays)
KASP Sequence:
KGAGTGATGTGTTTGACCTGAGGCATTTACTCTCTTTTTAGATCCAGAGG[A/T]GTTCCTCAACATCCTGTTTCATCACATCCTGAGAGTTGATCCTCTTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18879
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084249 Nonsense 798 951 14 16
ENSDART00000084249 Nonsense 798 951 14 16
Genomic Location (Zv9):
Chromosome 7 (position 38910699)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37247339
GRCz11 7 37518597
KASP Assay ID:
554-6142.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATGTCGAATCTGTGGAGGTTTAGCTCTATATGAGTGCAGAGAGTGCTA[T/A]GAAGATTATGACATCACACCAGGAAAGATCAAGCAGTTCTGTGAAAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16446
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084249 Nonsense 798 951 14 16
ENSDART00000084249 Nonsense 798 951 14 16
Genomic Location (Zv9):
Chromosome 7 (position 38910699)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37247339
GRCz11 7 37518597
KASP Assay ID:
554-6142.1 (used for ordering genotyping assays)
KASP Sequence:
GAATGTCGAATCTGTGGAGGTTTAGCTCTATATGAGTGCAGAGAGTGCTA[T/A]GAAGATTATGACATCACACCAGGAAAGATCAAGCAGTTCTGTGAAAAGTG
Associated Phenotype:
Not determined