Busch Lab

ZMP

setd1a

Ensembl ID:
ENSDARG00000060030
ZFIN ID:
ZDB-GENE-080521-4
Description:
KIAA0339 protein [Source:UniProtKB/TrEMBL;Acc:Q071D7]
Human Orthologue:
SETD1A
Human Description:
SET domain containing 1A [Source:HGNC Symbol;Acc:29010]
Mouse Orthologue:
Setd1a
Mouse Description:
SET domain containing 1A Gene [Source:MGI Symbol;Acc:MGI:2446244]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa11613 Nonsense Available for shipment Available now
sa44565 Nonsense Mutation detected in F1 DNA Not yet available
sa14532 Nonsense Available for shipment Available now
sa20054 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa11613
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083821 None None 406 None 7
ENSDART00000125022 None 683 1916 16 38
ENSDART00000131774 None None 322 None 7
ENSDART00000137062 Nonsense 64 180 2 2
ENSDART00000142133 None None 310 None 8
ENSDART00000147403 None None 255 None 2
Genomic Location (Zv9):
Chromosome 3 (position 32859955)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32591265
GRCz11 3 32722979
KASP Assay ID:
2259-3686.1 (used for ordering genotyping assays)
KASP Sequence:
CTTCTTCATCCTCTTCACCAGCAGCTTCCTCACAGACTGTCCTCYCATCC[C/T]AAACCACAGACCCCTCTGCAAGCCCTGCCCCTGACACCAGCCAGCACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44565
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083821 None None 406 None 7
ENSDART00000125022 Nonsense 920 1916 20 38
ENSDART00000131774 None None 322 None 7
ENSDART00000137062 None None 179 None 2
ENSDART00000142133 Nonsense 84 310 2 8
ENSDART00000147403 None None 255 None 2
Genomic Location (Zv9):
Chromosome 3 (position 32861031)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32592341
GRCz11 3 32724055
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGACGACAAGCAATCGACCTAGAGAGCCACTCATGTCTCTGGTAGACTG[G/A]GCTAAGAGTGGAGGCATGGAGGGTTTCTCCCTGCGGGGGGCATTGCGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14532
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083821 None None 406 None 7
ENSDART00000125022 Nonsense 1518 1916 30 38
ENSDART00000131774 None None 322 None 7
ENSDART00000137062 None None 180 None 2
ENSDART00000142133 None None 310 None 8
ENSDART00000147403 None None 255 None 2
Genomic Location (Zv9):
Chromosome 3 (position 32866777)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32598087
GRCz11 3 32729801
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAACCACTMCTGGATCCAGAGGGTCTATTYGTCATGCAGGAGCACAACTA[T/G]TCTAAAACTCCTGCACCTCAACACAWTACGCCTCCACAGAAGARGACGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20054
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083821 None None 406 None 7
ENSDART00000125022 Missense 1583 1916 31 38
ENSDART00000131774 None None 322 None 7
ENSDART00000137062 None None 180 None 2
ENSDART00000142133 None None 310 None 8
ENSDART00000147403 None None 255 None 2
Genomic Location (Zv9):
Chromosome 3 (position 32867049)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32598359
GRCz11 3 32730073
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTAGCTCACCATACAAGAGGACCGGCTCGATCAGCAAAGAGGTGGATT[T/A]GGAGGAGAGGGGGAAAGGTAAAAACAAGAAGAGAAGTAGGAAGGACAAAG
Associated Phenotype:
Not determined