Busch Lab

ZMP

ncapg2

Ensembl ID:
ENSDARG00000060023
ZFIN IDs:
ZDB-GENE-070410-100, ZDB-GENE-070410-100
Description:
condensin-2 complex subunit G2 [Source:RefSeq peptide;Acc:NP_001082961]
Human Orthologue:
NCAPG2
Human Description:
non-SMC condensin II complex, subunit G2 [Source:HGNC Symbol;Acc:21904]
Mouse Orthologue:
Ncapg2
Mouse Description:
non-SMC condensin II complex, subunit G2 Gene [Source:MGI Symbol;Acc:MGI:1923294]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa16326 Essential Splice Site Available for shipment Available now
sa18884 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10405 Essential Splice Site Available for shipment Available now
sa2364 Nonsense Available for shipment Available now
sa40970 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12675 Essential Splice Site Available for shipment Available now
sa40971 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16326
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084090 Essential Splice Site 128 1140 3 26
ENSDART00000084093 None None 322 None 9
Genomic Location (Zv9):
Chromosome 7 (position 41600431)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39936688
GRCz11 7 40207705
KASP Assay ID:
2259-9278.1 (used for ordering genotyping assays)
KASP Sequence:
GAAAAKGACAATTATACCACTCTTCTCAAATGTGCCCAGATGCTGAATGG[T/G]ATGGACTTTTATTGTCACTCTTCATCTAGACATTTCTGNTTTTTTGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18884
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084090 Essential Splice Site 442 1140 10 26
ENSDART00000084093 None None 322 None 9
ENSDART00000084090 Essential Splice Site 442 1140 10 26
ENSDART00000084093 None None 322 None 9
Genomic Location (Zv9):
Chromosome 7 (position 41605470)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39941781
GRCz11 7 40212798
KASP Assay ID:
554-6147.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGCTAATGACACCAGCTCTCCAGATGTCCGCTGCTCTGTCTTCATGG[T/C]AAAGCCCCTGGCTGACTGTCTGTCACTGAGTGACAAAGTGCTGCTTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10405
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084090 Essential Splice Site 442 1140 10 26
ENSDART00000084093 None None 322 None 9
ENSDART00000084090 Essential Splice Site 442 1140 10 26
ENSDART00000084093 None None 322 None 9
Genomic Location (Zv9):
Chromosome 7 (position 41605470)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39941781
GRCz11 7 40212798
KASP Assay ID:
554-6147.1 (used for ordering genotyping assays)
KASP Sequence:
GCTGGCTAATGACACCAGCTCTCCAGATGTCCGCTGCTCTGTCTTCATGG[T/C]AAAGCCCCTGGCTGACTGTCTGTCACTNNNTGACAAAGTGCTGCTTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2364
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084090 Nonsense 448 1140 11 26
ENSDART00000084093 None None 322 None 9
Genomic Location (Zv9):
Chromosome 7 (position 41605878)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39942187
GRCz11 7 40213204
KASP Assay ID:
554-2876.1 (used for ordering genotyping assays)
KASP Sequence:
AGCCTTTGTTATACCCTGTTTGTTTGCTCTGCAGTGTATKTCTATAATTT[T/A]GGATAACAGTTTAAGTCATCCACTCATGGAAAAACTGTTGCCTGCATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40970
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084090 Essential Splice Site 657 1140 14 26
ENSDART00000084093 None None 322 None 9
Genomic Location (Zv9):
Chromosome 7 (position 41608252)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39944562
GRCz11 7 40215579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACTGCAAAGTTTGGATCTTCTCTGCCCCAATACCTTAAAATCTTTCAG[G/A]TAAGAGGCACGTTCAAGCGATGAAACCAAAGGACAATTTAAAGATCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12675
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084090 Essential Splice Site 657 1140 14 26
ENSDART00000084093 None None 322 None 9
Genomic Location (Zv9):
Chromosome 7 (position 41608253)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39944563
GRCz11 7 40215580
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTGCAAAGTTTGGATCTTCTCTGCCCCARTACCTTAAAATCTTTCAGG[T/C]AAGAGGCACGTTCAAGCGATGAAACCAAAGGACAATTTAAAGATCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40971
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084090 Essential Splice Site 732 1140 16 26
ENSDART00000084093 None None 322 None 9
Genomic Location (Zv9):
Chromosome 7 (position 41609019)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39945329
GRCz11 7 40216346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTGGAGCTTATCGAGAACTGGCTCACTGAGGCCGCACCTGTGAAAGAG[G/A]TACATGTGCTGGAAAGTGTCTATGTGTGGGGGTCATTATTAAGGCTGGGT
Associated Phenotype:
Not determined