Busch Lab

ZMP

nedd4l

Ensembl ID:
ENSDARG00000060006
ZFIN ID:
ZDB-GENE-051118-2
Description:
Novel protein similar to vertebrate neural cell expressed, developmentally down-regulated 4 (NEDD4)
Human Orthologue:
NEDD4L
Human Description:
neural precursor cell expressed, developmentally down-regulated 4-like [Source:HGNC Symbol;Acc:7728]
Mouse Orthologue:
Nedd4l
Mouse Description:
neural precursor cell expressed, developmentally down-regulated gene 4-like Gene [Source:MGI Symbol;

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43589 Nonsense Mutation detected in F1 DNA Not yet available
sa37245 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14628 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43589
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084061 Nonsense 6 1011 1 33
ENSDART00000146576 Nonsense 6 988 1 31
Genomic Location (Zv9):
Chromosome 21 (position 9589909)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 10961962
GRCz11 21 11054590
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGTATGTGTGTGTTAAATTGCCTTTTGGCTTTATGGCTACGAATTTT[G/T]AACCCATTTATGGACTTTCAGAGGATGAAGTAAGTACTGTTTTTTCAAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29530
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084061 Essential Splice Site 40 1011 3 33
ENSDART00000146576 Essential Splice Site 40 988 3 31
Genomic Location (Zv9):
Chromosome 21 (position 9528615)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 10900668
GRCz11 21 10993296
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAATATATTATGTGTTTTTCATTTTTATAATGCATTTTTTTTCCTTCTA[G/T]TGATCCATACGTCAAACTCTCCCTGTATGTCGCTGATGAAAACCGCGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37245
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084061 Essential Splice Site 187 1011 9 33
ENSDART00000146576 Essential Splice Site 170 988 8 31
Genomic Location (Zv9):
Chromosome 21 (position 9490018)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 10862071
GRCz11 21 10954699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATGGAGGACATGAGGAGGAAAGCGGTGAAATGAGAGAGGAGGCTGAGG[T/C]GAAGTATATCCATCCACACACTCATTTTTTTTATTAATACCGTAGTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14628
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084061 Essential Splice Site 625 1011 20 33
ENSDART00000146576 Essential Splice Site 602 988 19 31
Genomic Location (Zv9):
Chromosome 21 (position 9442760)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 10814813
GRCz11 21 10907441
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACACAGTGGGAAGACCCTCGTCTCCAGAGTCCTGCCATAACTGGACCC[G/T]TAAGTGTTTTTCTCKTATTTTGCAGTCACAATCTGTCTCTTTCTGTATAT
Associated Phenotype:
Not determined